Labshake search
Citations for Thermo Fisher :
3851 - 3900 of 6229 citations for STAT3 Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: Human colon adenocarcinoma cells (Caco-2) were cultured in high-glucose Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco) supplemented with 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Microbiology 2021Quote: ... 5μl were used for quantitative PCR with primer/probe sets for human GAPDH (Applied Biosystems Cat# Hs99999905_m1) and HIV-1 genomic RNA (primers GGCCAGGGAATTTTCTTCAGA / TTGTCTCTTCCCCAAACCTGA (forward/reverse ...
-
bioRxiv - Biophysics 2021Quote: The cDNA of human PDI (residues 18-479) was cloned into a pBAD vector expression system (ThermoFisher) and modified to include an N-terminal 6 his-tag and a C-terminal Avitag ...
-
bioRxiv - Biophysics 2021Quote: ... and both HRP-conjugated anti-mouse IgG Fc and anti-human IgG Fc were purchased from Invitrogen™ (Waltham ...
-
bioRxiv - Immunology 2020Quote: ... BHLHE41 expression in human B cell subsets was assessed by PrimeFlow RNA assay (Thermo Fisher, Oberhausen, Germany) with high sensitivity Alexa Fluor 647-probe targeting human BHLHE41 normalized on CD8A-probe.
-
bioRxiv - Cancer Biology 2021Quote: ... and the human colon adenocarcinoma cell lines were cultured in DMEM medium (Gibco, Thermo Fisher Scientific, France). All the media were supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the human colon adenocarcinoma cell lines were cultured in DMEM medium (Gibco, Thermo Fisher Scientific, France). All the media were supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Bioengineering 2020Quote: ... Fifty microliter clots were formed from purified fibrinogen using 0.25 U/mL human alpha-thrombin (Fisher Scientific), 2 mg/mL fibrinogen (Enzyme Research Laboratories) ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-rabbit IgG antibodies (1:500 for IF) and recombinant human BMP2 (#PHC7145) were from Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2021Quote: ... Human lung (Calu-3) (ATCC, HTB-55) cells were cultured in Minimum Essential Media (MEM) (Gibco; 11095080) supplemented with 10% FBS with 1mM sodium pyruvate (Gibco ...
-
bioRxiv - Bioengineering 2021Quote: T cells from 3 donors were thawed and activated using Dynabeads Human T-Activator CD3/CD28 (ThermoFisher) for 24 hours ...
-
bioRxiv - Cell Biology 2021Quote: Human iPSCs (male WTC11 background24) were cultured in Essential 8 (E8) Medium (ThermoFisher Scientific cat. no. A1517001) on BioLite Cell Culture Treated Dishes (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... small interfering RNAs (siRNAs) targeting human MPI were transfected using Lipofectamine RNAiMAX transfection reagent (ThermoFisher, Waltham, MA), as previously described (15) ...
-
bioRxiv - Systems Biology 2021Quote: ... MDA-MB-231 human breast cancer cells were cultured in DMEM/F12 (1:1) media52 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... secondary antibody (chicken anti-rabbit Alexa Fluor-488, Invitrogen, or goat anti-human Alexa Fluor-488, Invitrogen) diluted 1:400 in PBS containing 0.1% (v/v ...
-
bioRxiv - Systems Biology 2021Quote: Human gingival tissues were minced and digested for 50 minutes at 37°C with Collagenase IV (Gibco) and DNAse (Sigma) ...
-
bioRxiv - Neuroscience 2021Quote: Aβ concentration in conditioned medium from individual wells measured using the human Aβ42 ELISA kit (Thermo Fisher), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Human hepatocytes (male donor, age 57) were maintained in DMEM with 10% fetal bovine serum (FBS, GIBCO), 1% ITS (insulin/transferrin/selenous acid and linoleic acid ...
-
bioRxiv - Microbiology 2021Quote: ... Goat anti-mouse and anti-human antibodies pre-coupled to Alexa Fluor 647 (Invitrogen, Rockford, IL, USA) were used as secondary antibodies in flow cytometry experiments ...
-
bioRxiv - Microbiology 2021Quote: ... 50 µL of a 1:100 dilution of mouse anti-human IgM phycoerythrin conjugate (Invitrogen, MA1-10381) or goat anti-human IgG phycoerythrin conjugate (Sigma ...
-
bioRxiv - Cancer Biology 2020Quote: ... The human glioma cell lines were cultured in DMEM containing 2mM L-glutamine (ThermoFisher Scientific, 25030-24), non-essential amino acids (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... and Rabbit anti-Human IgG F(ab’)2 HRP Secondary Antibody (ThermoFisher Scientific Catalog #31482, 1:10,000).
-
bioRxiv - Neuroscience 2020Quote: Human H4 neuroglioma cells were maintained at 37°C in OPTI-MEM I (Gibco, Invitrogen, CA, USA) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2020Quote: Human H4 neuroglioma cells were maintained at 37°C in OPTI-MEM I (Gibco, Invitrogen, CA, USA) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2019Quote: ... The secondary anti-human TRITC antibody (Thermo Fisher; 1:200 in 0.01% acBSA in PBS, pH 7.2) was used in this assay ...
-
bioRxiv - Microbiology 2021Quote: ... cells were further stained using alexa-555 conjugated donkey anti-human IgG (Thermo Fisher Scientific, Cat# A21433). After extensive washing ...
-
bioRxiv - Molecular Biology 2020Quote: Human β-cells were seeded onto collagen coated 8-well chambered cover glasses (Lab-Tek, Thermo Scientific) at a density of 70,000 cells/cm2 ...
-
bioRxiv - Microbiology 2020Quote: The concentration of culture supernatants and MMP-9 were measured by Human MMP-9 ELISA Kit (Invitrogen) according to manufacturer’s instructions.
-
bioRxiv - Microbiology 2020Quote: ... Standard curves were obtained by dilutions in PBS of purified human IgG (Cat. 02-7102, Invitrogen, USA) or IgA (Cat ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human embryonic kidney 293 (HEK-293T) cells were stably transfected with the plasmids using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Released IL-1β was quantified using the Human IL-1 beta ELISA Ready-Set-Go! Kit (ThermoFisher) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing 2 datasets in which 163 samples were analyzed using the GPL96 (Affymetrix Human Genome U133A Array) platform and 80 samples were analyzed using GPL570 (Affymetrix Human Genome U133 Plus 2.0 Array ...
-
Pseudohypoxic HIF pathway activation dysregulates collagen structure-function in human lung fibrosisbioRxiv - Cell Biology 2021Quote: ... cDNA libraries were prepared using Ion Ampli-Seq-transcriptome human gene expression kit (Life Technologies, Paisley, UK) and sequenced using Ion Torrent Proton Sequencer ...
-
bioRxiv - Neuroscience 2022Quote: OPG in the CSF was measured using the Human TNFRSF11B(OPG) Elisa kit (Thermo Fisher Scientific, Germany). The assay was performed according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Wells were then incubated with a secondary goat anti-human IgG labelled with horseradish peroxidase (HRP) (Invitrogen) or with a rabbit polyclonal anti-human IgA alpha-chain labelled with HRP (Abcam ...
-
bioRxiv - Cell Biology 2022Quote: After treatment of undifferentiated human iPSCs with a final concentration of 0.1 μg/mL Colcemid (Thermo Scientific) for 2 h ...
-
bioRxiv - Biochemistry 2022Quote: ... and BT474 human breast ductal carcinoma cells purchased from ATCC (LGC Promochem) were cultured in DMEM (Invitrogen) and supplemented with 10 % fetal calf serum (PAA Lab-oratories) ...
-
bioRxiv - Molecular Biology 2022Quote: The human hepatic Huh7 cells (JCRB0403) were maintained in Dulbecco’s modified eagle medium (DMEM, Gibco, the Netherlands) containing 10% fetal bovine serum (FBS) ...
-
bioRxiv - Molecular Biology 2022Quote: The human wild-type full-length D1R gene was cloned into a pcDNA3.1(+) vector (Thermo Fisher Scientific) with the signal peptide substituted by that of hemagglutinin (HA) ...
-
bioRxiv - Microbiology 2022Quote: Recombinant human CD81 protein (R &D Systems) was coated (4µg/ml) on ELISA plate (Thermo Fisher Scientific) and incubated overnight at 40C ...
-
bioRxiv - Biochemistry 2022Quote: Human embryonic kidney cells (HEK293T, ATCC CRL-3216) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen) supplemented with 10% calf serum for all experiments except immunofluorescence imaging where 10% FBS was used ...
-
bioRxiv - Cell Biology 2022Quote: Human Sertoli cells were from Guyana Biotech (Shanghai) and cultured in DMEM with 10% FBS (Invitrogen, Shanghai) at 37°C in a cell incubator containing 5% CO2.
-
bioRxiv - Neuroscience 2021Quote: Cell viability was assessed using a Human caspase-3 (active) ELISA kit (#KHO1091; Thermo Fisher Scientific, MA) following manufacture’s protocols ...
-
bioRxiv - Microbiology 2020Quote: ... and MoMab (human) and according secondary antibodies coupled to horseradish peroxidase (Thermo Fisher Scientific, Carlsbad, CA, USA). Histological analysis of the 2 µm paraffin-embedded tissue sections was performed with the Bond Polymer Refine Detection Kit (Leica ...
-
bioRxiv - Biochemistry 2021Quote: ... Selected CD4+ T cells were activated by Dynabeads™ Human T-Activator CD3/CD28 kit (ThermoFisher Scientific) and were maintained in RPMI 1640 with 10% FBS ...
-
bioRxiv - Microbiology 2020Quote: ... followed by incubation with Alexa Fluor 594 conjugated goat anti-human IgG antibody (Invitrogen, Thermo Fisher Scientific) for 45 min at RT ...
-
bioRxiv - Microbiology 2020Quote: ... followed by incubation with Alexa Fluor 594 conjugated goat anti-human IgG antibody (Invitrogen, Thermo Fisher Scientific) for 45 min at RT ...
-
bioRxiv - Microbiology 2020Quote: ... Supernatants were collected and quantified by western blotting using anti-human IgG secondary antibody (ThermoFisher A-21091). SARS-CoV-2 S-614D and S-614G proteins containing polyhistidine- and avi-tagged full-length ectodomain (residues 1-1208 ...
-
bioRxiv - Cell Biology 2021Quote: Peak lists were searched against the complete human proteome (UniProt release 2014_08, with 68.049 proteins) using SEQUEST (Proteome Discoverer 1.3, ThermoFisher) as search engine ...
-
bioRxiv - Microbiology 2020Quote: The human intestinal epithelial cells HT29 ATCC HTB3831 were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM, Thermofisher) supplemented with 10% foetal bovine serum (Gibco) ...