Labshake search
Citations for Thermo Fisher :
3801 - 3850 of 6212 citations for ZBED1 Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... soluble extracellular domain (ECD) of human CD58 was produced either in Freestyle 293F suspension cells (Thermo Fisher) or adherent HEK 293T cells ...
-
bioRxiv - Neuroscience 2021Quote: ... Human recombinant full length wild type Flag-LRRK2 (#A15198) and Flag-LRRK2[G2019S] (#A15201) were from ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: Human iPSCs (male WTC11 background77) were cultured in Essential 8 (E8) Medium (ThermoFisher Scientific cat. no. A1517001) on BioLite Cell Culture Treated Dishes (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Myc-tagged human Insig1 (NM_005542) were prepared by subcloning PCR products into the pcDNA3 vector (Invitrogen). YFP-tagged human RHBDL4 and YFP-human SREBP-1c-CFP were prepared by subcloning PCR products into the pCI-EYFP vector ...
-
bioRxiv - Molecular Biology 2020Quote: ... primary Hs27 human fetal foreskin fibroblasts (ATCC Cat#CRL-1634) all maintained in DMEM (Gibco Cat# 11995065) supplemented with 10% FBS and 1% antibiotic/antimycotic ...
-
bioRxiv - Molecular Biology 2021Quote: ... we modified the default protocol of the Ion AmpliSeq Transcriptome Human Gene Expression kit (Thermo Fisher Scientific). Briefly ...
-
bioRxiv - Bioengineering 2022Quote: Human or mouse CDCs were transfected with small interfering RNAs against Drosha (Thermo Fisher HSS178992 or MSS274198) or a Medium GC Content Negative Control (Thermo Fisher ...
-
bioRxiv - Bioengineering 2022Quote: Flp-In T-REx Human Embryonic Kidney (HEK) 293 cells were purchased from Thermo Scientific (catalog #R78007). Cells were cultured in a humidity-controlled incubator under standard culture conditions (37°C with 5% CO2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Full-length human SAMD1 was produced by Cell & Molecular Technologies (CMT, Phillipsburg, NJ, now Invitrogen, Carlsbad, CA) in HEK293 cells ...
-
bioRxiv - Genomics 2020Quote: ... isolated single cells were stained with mouse anti-human CD34 biotinylated antibody (clone 581, Thermo Fisher Scientific) diluted 5µL for 106 cells in FACS buffer (DPBS with 2% FBS and 1mM EDTA ...
-
bioRxiv - Microbiology 2020Quote: ... TNFα using the ProcartaPlex high sensitivity 9-Plex Human Panel (EPXS090-12199-901, Thermofisher Scientific, Waltham, MA). Samples were measured using a Luminex MAGPIX instrument (Luminex Corporation ...
-
bioRxiv - Microbiology 2020Quote: Human 293F cells were maintained at 37°C with 5% CO2 in FreeStyle 293 Expression Medium (ThermoFisher) supplemented with penicillin and streptomycin ...
-
bioRxiv - Cancer Biology 2020Quote: Human Embryonic Kidney (HEK-293) cells were cultivated in DMEM (Gibco®, Thermo Scientific, Carlsbad, CA, USA) supplemented with 10% FBS,2mM glutamine and 1% penicillin/streptomycin.
-
bioRxiv - Cancer Biology 2020Quote: Human Embryonic Kidney (HEK-293) cells were cultivated in DMEM (Gibco®, Thermo Scientific, Carlsbad, CA, USA) supplemented with 10% FBS,2mM glutamine and 1% penicillin/streptomycin.
-
bioRxiv - Genetics 2020Quote: ... reference primers/probe (VIC, TaqMan™ Copy Number Reference Assay, human, RNase P, 4403326; ThermoFisher, Waltham, MA)] and applied to a X200™ Droplet Generator (1864002 ...
-
bioRxiv - Neuroscience 2019Quote: ... Human synaptosomes were labeled with blue fluorescent 2.0 µm FluoSpheres™ Carboxylate-Modified Microspheres (Life technologies, F8824) according to manufacturer instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... After an overnight rest 20 μL of Dynabeads™ Human T-Activator CD3/CD28 (Thermo Fisher #1131D) were added per well and incubated for 24 hours ...
-
bioRxiv - Bioengineering 2019Quote: ... 10x of mouse (for NIH 3T3 cells) or human (for HCT116 cells) Cot-1 DNA (Thermo Fisher Scientific Cat ...
-
bioRxiv - Immunology 2019Quote: Human peripheral blood or umbilical cord blood was diluted with an equal volume of RPMI-1640 (Gibco), overlaid on Histopaque (Sigma) ...
-
bioRxiv - Neuroscience 2019Quote: ... and 5 μg/mL human recombinant laminin 521 (BioLamina #LN521-02) in E8 basal medium (Gibco #A1517001) supplemented with 1% Penicillin/Streptomycin (Pen/Strep ...
-
bioRxiv - Immunology 2019Quote: Cryopreserved T cells were thawed and activated same day with Human T-Expander CD3/CD28 Dynabeads (Gibco) at 3:1 beads:cell ratio in T cell media (AIMV supplemented with 5% FBS ...
-
bioRxiv - Developmental Biology 2020Quote: Primary prenatal human microglia were MACS-purified as described above and labeled with DiI (Thermo Fisher, V22885) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... Alexa Fluor conjugated secondary antibodies used: goat anti-human Alexa-488 (1:1000, Cat. # A11013, Life Technologies), donkey anti-mouse Alexa-594 (1:1000 ...
-
bioRxiv - Systems Biology 2019Quote: Full-length cDNAs were obtained from the human ORFeome v5.1 entry clone collection (Thermo Fisher, Open Biosystems) and sequence verified ...
-
bioRxiv - Immunology 2019Quote: ... Corresponding cDNAs were made by gene synthesis and codon-optimised for expression in human cells (Invitrogen, GeneArt). The ectodomains were flanked by unique NotI and AscI restriction enzyme sites and subcloned into an expression plasmid containing a high-scoring signal peptide [29] ...
-
bioRxiv - Microbiology 2019Quote: ... transformed into MaV203 and used as a bait to screen a human embryonic brain cDNA library (Invitrogen). Media ...
-
bioRxiv - Biochemistry 2019Quote: ... the human cell lines were seeded (1000 cells/well) using a multi-drop Combi (Thermo Fisher Scientific) on top of the compounds ...
-
bioRxiv - Microbiology 2021Quote: Human embryonic kidney 293 Freestyle (HEK293F) cells were maintained in Expi293 Expression Medium (Gibco, Waltham, MA, USA), at 37 °C in an 8% CO2 atmosphere ...
-
bioRxiv - Immunology 2021Quote: ... Human or mouse cell suspensions were seeded at approximately 2900 cells/cm2 in αMEM complete media (Invitrogen) and cultured in 10% batch selected FBS (Sigma Aldrich ...
-
bioRxiv - Genomics 2020Quote: ... Human PDCD1 or PDL1 cell surface protein staining was analyzed using anti-PD-1 (ThermoFisher clone MIH4) or anti-PD-L1 (ThermoFisher clone MIH1 ...
-
bioRxiv - Neuroscience 2020Quote: ... the medium was changed to human endothelial serum-free medium (HESFM, Thermo Fisher Scientific, cat no. 11111044) supplemented with 20 ng/mL bFGF (Peprotech ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA from HEK293 cells and human brain prefrontal cortex were isolated with the TRIzol reagent (Ambion) according to the manufacturer’s recommendations ...
-
bioRxiv - Systems Biology 2020Quote: ... Caco-2 human colorectal adenocarcinoma (ATCC HTB-37) were maintained in Dulbecco’s modified Eagle’s medium (DMEM) (GibCo) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin (Gibco) ...
-
bioRxiv - Bioengineering 2020Quote: Human colon adenocarcinoma cells (Caco-2) were cultured in high-glucose Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco) supplemented with 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Microbiology 2021Quote: ... 5μl were used for quantitative PCR with primer/probe sets for human GAPDH (Applied Biosystems Cat# Hs99999905_m1) and HIV-1 genomic RNA (primers GGCCAGGGAATTTTCTTCAGA / TTGTCTCTTCCCCAAACCTGA (forward/reverse ...
-
bioRxiv - Biophysics 2021Quote: The cDNA of human PDI (residues 18-479) was cloned into a pBAD vector expression system (ThermoFisher) and modified to include an N-terminal 6 his-tag and a C-terminal Avitag ...
-
bioRxiv - Biophysics 2021Quote: ... and both HRP-conjugated anti-mouse IgG Fc and anti-human IgG Fc were purchased from Invitrogen™ (Waltham ...
-
bioRxiv - Immunology 2020Quote: ... BHLHE41 expression in human B cell subsets was assessed by PrimeFlow RNA assay (Thermo Fisher, Oberhausen, Germany) with high sensitivity Alexa Fluor 647-probe targeting human BHLHE41 normalized on CD8A-probe.
-
bioRxiv - Cancer Biology 2021Quote: ... and the human colon adenocarcinoma cell lines were cultured in DMEM medium (Gibco, Thermo Fisher Scientific, France). All the media were supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the human colon adenocarcinoma cell lines were cultured in DMEM medium (Gibco, Thermo Fisher Scientific, France). All the media were supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Bioengineering 2020Quote: ... Fifty microliter clots were formed from purified fibrinogen using 0.25 U/mL human alpha-thrombin (Fisher Scientific), 2 mg/mL fibrinogen (Enzyme Research Laboratories) ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-rabbit IgG antibodies (1:500 for IF) and recombinant human BMP2 (#PHC7145) were from Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2021Quote: ... Human lung (Calu-3) (ATCC, HTB-55) cells were cultured in Minimum Essential Media (MEM) (Gibco; 11095080) supplemented with 10% FBS with 1mM sodium pyruvate (Gibco ...
-
bioRxiv - Bioengineering 2021Quote: T cells from 3 donors were thawed and activated using Dynabeads Human T-Activator CD3/CD28 (ThermoFisher) for 24 hours ...
-
bioRxiv - Cell Biology 2021Quote: Human iPSCs (male WTC11 background24) were cultured in Essential 8 (E8) Medium (ThermoFisher Scientific cat. no. A1517001) on BioLite Cell Culture Treated Dishes (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... small interfering RNAs (siRNAs) targeting human MPI were transfected using Lipofectamine RNAiMAX transfection reagent (ThermoFisher, Waltham, MA), as previously described (15) ...
-
bioRxiv - Systems Biology 2021Quote: ... MDA-MB-231 human breast cancer cells were cultured in DMEM/F12 (1:1) media52 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... secondary antibody (chicken anti-rabbit Alexa Fluor-488, Invitrogen, or goat anti-human Alexa Fluor-488, Invitrogen) diluted 1:400 in PBS containing 0.1% (v/v ...
-
bioRxiv - Systems Biology 2021Quote: Human gingival tissues were minced and digested for 50 minutes at 37°C with Collagenase IV (Gibco) and DNAse (Sigma) ...
-
bioRxiv - Neuroscience 2021Quote: Aβ concentration in conditioned medium from individual wells measured using the human Aβ42 ELISA kit (Thermo Fisher), following the manufacturer’s instructions ...