Labshake search
Citations for Thermo Fisher :
3801 - 3850 of 10000+ citations for 6 Methoxy 2 3 4 9 tetrahydro 1H b carbolin 1 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... after which 9 ml Essential 8 medium (Thermo Fisher Scientific, A1517001) was added to the well for resuspension ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were incubated in Gibco ™ LHC-9 medium (Thermo Fisher) and kept incubated at 37 °C and 5% CO2 until they reached the desired confluence ...
-
bioRxiv - Cancer Biology 2023Quote: ... mounted with fluorescence mounting medium (9 ml of glycerol [Fisher Scientific cat#BP229-1] ...
-
bioRxiv - Cancer Biology 2024Quote: ... Each plasmid was mixed with 9 μL of Lipofectamine2000 (Invitrogen, UA) and incubated for 20 minutes at room temperature before being transferred into the growth medium ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 9 hpi with the fluorometer Fluoroskan Ascent FL (Thermo Fisher). Each measure was compared with the values obtained at 0 hpi.
-
bioRxiv - Cell Biology 2024Quote: ... and 5 μg LentiCRISPRv2blasti hcaspase-9 using Lipofectamine 2000 (Life Technologies). The following day the medium was changed to fresh medium containing 20% FBS ...
-
bioRxiv - Neuroscience 2021Quote: ... and then incubated for 2 h at room temperature with one of the species-matching conjugated secondary antibodies (all from ThermoFisher Scientific): goat anti-mouse Alexa-Fluor 555 (cat ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR (SARS-CoV-2 and MS2 viral genome detection) were performed with the Express one step RT-qPCR Universal kit (ThermoFisher Scientific) using 3.5µL of RNA and 6.5µL of RT-qPCR mix that contains 250nmol of each primer and 75nmol of probe ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The final pooled library was diluted to an appropriate concentration and then subjected to Ion Sphere Particle (ISP) emulsion PCR amplification using an Ion One Touch 2 and an Ion PI Template OT2 200 Kit (Life Technologies). We sequenced the final library in two runs on an Ion Torrent Personal Genome Machine (Life Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... One half of each tissue sample was homogenised in 1ml DMEM medium containing 2% FBS supplemented with Penicillin/Streptomycin (Gibco, USA) for 5min at 30Hz using a Tissue Lyser II (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 nucleoprotein cDNA was generated from RNA from Bei Resources (NR-52285) by One-Step RT PCR (SuperScript IV, Thermo Fisher) with primers SARS CoV-2 N IVT F1 (5’-GAATTCTAATACGACTCACTATAGGGGATGTCTGATAATGGACCC-3’ ...
-
bioRxiv - Biochemistry 2021Quote: ... The protein was run over either one (at 10°C) or two (at 10°C and 2°C) immobilized pepsin columns (Applied Biosystems; Poroszyme Immobilized Pepsin Cartridge ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 nucleoprotein cDNA was generated from RNA from Bei Resources (NR-52285) by One-Step RT PCR (SuperScript IV, Thermo Fisher) with primers SARS COV-2 N IVT F1 (5’-GAATTCTAATACGACTCACTATAGGGGATGTCTGATAATGGACCC-3’ ...
-
bioRxiv - Immunology 2021Quote: ... and the SARS-CoV-2 spike gene was reverse-transcribed and amplified with a SuperScript IV One-Step RT-PCR kit (ThermoFisher Scientific) using primers flanking the S gene ...
-
bioRxiv - Bioengineering 2023Quote: ... mRNA was co-transcriptionally capped using m7(3’OMeG)(5’)ppp(5’)(2’OMeA)pG capping reagent (Hongene Biotech) in a “one-pot” reaction followed by digestion with DNase I (Thermo Fisher). Linear mRNA was purified using Dynabeads MyOne Carboxylic Acid beads (Thermo Fisher).
-
bioRxiv - Molecular Biology 2023Quote: Cas12a-gRNA ribonucleoprotein complexes containing one sgRNA targeting the vault1-2 gene (TTTAGCTCAGCGGTTACTTCGAGTACA) were nucleofected in HEK293T using Neon Transfection System (Thermo Scientific). After 48 hours cells were single-cell sorted into 96-well plates and subsequently genotyped ...
-
bioRxiv - Biochemistry 2023Quote: ... The temperature was increased from 5 °C to 95 °C over 2 hours and readings taken using a One Step Plus RT-PCR (Applied Biosystems).
-
bioRxiv - Physiology 2023Quote: ... cells were incubated with fresh DMEM containing DDAO galactoside (9H-(1,3-dichloro-9,9-dimethylacridin-2-one-7-yl) β-D-Galactopyranoside) (Molecular Probes™) for 2 hours ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Gels were then rinsed one time in deionized water and placed into an iBlot 2 mini transfer stack (Thermo Fisher Scientific). The transfer stack was loaded onto the iBlot 2 Gel Transfer Device (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were then blocked for one hour at room temperature with a blocking reagent 2% bovine serum albumin (BSA; Fisher Scientific) in PBS followed by staining with primary antibodies ...
-
bioRxiv - Pathology 2023Quote: ... which was previously labeled at its 5’ end with one of four specific fluorescent dyes (6-FAM®, NED®, PETTM and VICTM; Thermo Fisher Scientific, Waltham, MA, U.S.A) (Table 2) ...
-
bioRxiv - Cell Biology 2024Quote: ... a premium microscope slide (Fisher-finest, 3″ × 1″ × 1 mm; Thermo Fisher Scientific, 12-544-1) or chambered coverglass (1 well ...
-
bioRxiv - Neuroscience 2020Quote: ... Iba-1 (1:1000, Wako) and COX-2 (1:1000, Thermo Fisher) at 4°C overnight ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 micromols sodium sulfo-NHS and 5 micromols 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) (Thermo Fisher #22980) in 10 μL of DMSO ...
-
bioRxiv - Bioengineering 2021Quote: ... Celsus Laboratories) was reacted with peptide-hydrazides using 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC, ThermoFisher Scientific) in 0.1 M MES [2-(N-morpholino)ethanesulfonic acid] buffer with 8 M urea (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... and 50 µL of 50 mg/mL 1-ethyl-3-[3-dimethyl-aminopropyl]-carbodiimidehydrochloride (Thermo Fisher Scientific, 22981) were simultaneously added to the reaction tubes ...
-
bioRxiv - Biochemistry 2020Quote: ... 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) and N-hydroxysulfosuccinimide (Sulfo-NHS) were obtained from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Cell Biology 2024Quote: ... 4.0 × 107 beads were activated with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Thermo Fisher Scientific [TFS] 22980) and N-hydroxysuccinimide (NHS ...
-
bioRxiv - Immunology 2023Quote: ... 4.0 × 107 beads were activated with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Thermo Fisher Scientific [TFS] 22980) and N-hydroxysuccinimide (NHS ...
-
bioRxiv - Plant Biology 2021Quote: ... these were extracted and dialyzed against 25 mM Tris pH 7.5 at 4 °C and measured using a Nanodrop One (Thermo Fisher Scientific, Waltham, MA). Particles for cryo-EM were dialyzed against 20 mM NaOAc ...
-
bioRxiv - Neuroscience 2023Quote: ... The slices were incubated at 4°C for one day in PBT with 0.002% Streptavidin conjugated to Alexa Fluor 633 (ThermoFisher Scientific, Waltham, MA, USA), then washed two times in PBT and two times in PB ...
-
bioRxiv - Cancer Biology 2024Quote: ... They were then washed twice with Blocking One (Nacalai Tesque, 03953-95) and incubated overnight at 4 °C with primary antibodies diluted in 10% goat serum (Thermo Fisher Scientific, 16210064)/Blocking One ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μM Rhod-2 AM (Thermo, R1244) and 2 μM Calcium green-1 AM (Life Technologies, C3011MP) was added to culture media and allowed to stain at 22 °C for 20 min prior to imaging (frozen Rhod-2 AM aliquots were used only when the DMSO suspension remained clear) ...
-
bioRxiv - Neuroscience 2019Quote: ... 5% CO2 and 37°C in neuronal culture medium (Gibco Neurobasal medium supplemented with 1x Gibco B-27 supplement, 2 mM L-glutamine and 250 μM penicillin-streptomycin; all Thermo Fisher Scientific). After 24 h ...
-
bioRxiv - Microbiology 2020Quote: ... NSCs were differentiated into HMNs utilizing a neuronal differentiation medium prepared in Neurobasal Medium with B-27 Serum-Free supplement (2% [vol/vol]) (Thermo Fisher Scientific), and GlutaMAX-I (2 mM) ...
-
bioRxiv - Neuroscience 2019Quote: ... Dissociated cells were filtered through 40 µM strainer and washed twice in Hibernate-A media with B-27 (2%, Thermo Fisher Scientific), GlutaMAX (0.5 mM) ...
-
bioRxiv - Systems Biology 2024Quote: ... cells were cultured for 72h with 10 nM SB431542 in culture media containing DMEM/F12 with 1x GlutaMAX/1x insulin-transferrin- selenium/1x NEAA/2% B-27 (Gibco 17504-044)/90 µM 2-Merceptoethanol ...
-
bioRxiv - Neuroscience 2024Quote: ... using a 90 min gradient with a 250 nl/min flow rate of increasing Buffer B concentration (from 2% to 60%) on a High-Performance Liquid Chromatography (HPLC) system (Thermo Fisher Scientific), ionized with electrospray ionization (ESI ...
-
bioRxiv - Cell Biology 2023Quote: ... were cotransfected with pFRT-B-GRPA34 (Supplementary Table 2) (encoding GFP-RPA34) and pOG44 Flp-recombinase using Neon transfection (Cat.No.: MPK5000, Invitrogen, Waltham, Massachusetts, USA). Four hours after transfection the cell culture medium was exchanged and cells were grown for 48 h and selected with 2.5 mg ml-1 blasticidin (Cat.No. ...
-
bioRxiv - Immunology 2023Quote: To analyze proliferation in vitro, B cells (2 x 106, purified as above) were labeled with 5 µM CellTrace Violet (CTV) (Invitrogen, Waltham, MA) and then activated and cultured as above ...
-
bioRxiv - Immunology 2023Quote: RNA was isolated from day 2 LPS blasts seeded with sorted B cells using TRIzol reagent following the manufacturer’s instructions (Life Technologies, Carlsbad, CA). Genomic DNA was extracted from flow-purified naïve and GC B cells using lysis buffer (0.2% SDS ...
-
bioRxiv - Immunology 2024Quote: ... using a 90 min gradient with a 250 nL/min flow rate of increasing Buffer B concentration (from 2% to 60%) on a High-Performance Liquid Chromatography (HPLC) system (Thermo Fisher Scientific) and ionized using an electrospray ionization (ESI ...
-
bioRxiv - Molecular Biology 2024Quote: ... using a 90-minute gradient at a flow rate of 250 nL/min with increasing concentration of Buffer B (from 2 % to 60 %) on a high performance liquid chromatography (HPLC) system (Thermo Fisher Scientific), ionized with an electrospray ionization (ESI ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: We used para-chlorophenylalanine (PCPA, a.k.a. DL-4 Chlorophenylalanine, fenclonine) (CAS: 7424-00-2, ThermoFischer, Acros Organics, Geel, Belgium; stored at 4°C), an inhibitor of the enzyme tryptophan hydroxylase (TPH) ...
-
bioRxiv - Developmental Biology 2019Quote: ... pH=6 (ThermoFisher). Sections were then blocked for 1h at RT with 10% normal donkey serum (Chemicon International Inc ...
-
bioRxiv - Biochemistry 2024Quote: ... or 6% (Thermofisher) tris-glycine SDS-PAGE gels then transferred onto PVDF membranes using the Transblot rapid transfer machine (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... After incubation for 1h with the appropriate secondary antibodies (Alexa Fluor 488 or 594 (Thermo Fisher)) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and incubated for 1h on ice with or without RNase (10μg/mL RNase A) (Thermo Fisher). Lysate was centrifuged at 4°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... for 1h followed by incubation with goat α-rabbit Alexa Flour 488 (Thermo Fisher, A-11008) for 1h ...
-
bioRxiv - Developmental Biology 2023Quote: ... after 1h of secondary antibody incubation fluorochrome conjugated phalloidin (Alexa Fluor™ 546 Phalloidin, Invitrogen™) was added to the secondary antibody solution for F-actin membrane staining for another hour ...