Labshake search
Citations for Thermo Fisher :
3751 - 3800 of 10000+ citations for WY 45494 hydrochloride CAS 93413 90 2 99% since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... and Cy3 goat anti-rabbit (Invitrogen, Carlsbad, CA) at dilutions of ½000.
-
bioRxiv - Genetics 2021Quote: ... 96-Well (Applied Biosystems, Foster City, CA, USA). PCR conditions were as follows ...
-
bioRxiv - Microbiology 2021Quote: ... Lipofectamine 3000 transfection reagent (Invitrogen, Carlsbad, CA, USA) was used for transient transfection following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: Cells were lysed in TRIzol (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... and Qubit 3.0 fluorometry (Life Technologies, CA, USA) and stored at −20°C until further use.
-
bioRxiv - Genomics 2020Quote: ... grown in DMEM high glucose (Invitrogen; Carlsbad, CA) containing 15% fetal bovine serum and used at passage number <5 ...
-
bioRxiv - Immunology 2020Quote: ... using the TRI Reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... SuperScript III Reverse Transcriptase Kit (Invitrogen, CA, USA) was used for reverse transcription of RNA ...
-
bioRxiv - Microbiology 2020Quote: ... we used forward primer “TCCTACGGGAGGCAGCAGT” (Invitrogen, Carlsbad, CA) and reverse primer “GGACTACCAGGGTATCTAATCCTGTT” (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: The fragments encoding the P65 and P38 alleles genes were obtained from GenScript and cloned into pcDNA3.1 (Invitrogen, Carlsbad, CA, USA). 16HBE and RTE cells were transiently transfected with pcDNA3.1/p65 cDNA ...
-
bioRxiv - Microbiology 2020Quote: ... and quantified using Qubit Fluorometer 3.0 (Invitrogen, CA). The DNA samples were stored at −20°C until further use ...
-
bioRxiv - Immunology 2021Quote: ... using Lipofectamine 2000 (Thermo Fisher Scientific, CA, USA). Twenty-four hours later ...
-
bioRxiv - Microbiology 2021Quote: ... and Agilent 2100 bioanalyzer (ThermoFisher Scientific, CA, USA). Residual Ribosomal RNA (rRNA ...
-
bioRxiv - Microbiology 2020Quote: ... and quantified using Qubit(Invitrogen, Carlsbad, CA, USA). RNA integrity was checked using Agilent 2200 Tape Station system (Agilent Technologies ...
-
bioRxiv - Immunology 2020Quote: ... 0.2 μL PLUS™ Reagent (Invitrogen; Carlsbad, CA) per well ...
-
bioRxiv - Molecular Biology 2020Quote: ... then stood in TRIzol reagent (Invitrogen, CA, USA) for 15min ...
-
bioRxiv - Microbiology 2020Quote: ... anti-mouse Ig-HRP (Invitrogen, Carlsbad, CA, USA) or anti-rabbit Ig-HRP (GE Healthcare ...
-
bioRxiv - Immunology 2020Quote: ... and 1 mM sodium pyruvate (Invitrogen, Carlsbad, CA) as previously described(64) ...
-
bioRxiv - Cell Biology 2021Quote: ... Alexa Fluor 647 (Invitrogen, Carlsbad, CA ; Cat: S21374). ZO1 was detected with Rb A-ZO1 (Zymed ...
-
bioRxiv - Genetics 2020Quote: ... mouse anti-V5 (Thermo Fisher, CA; 1:1000), rabbit anti-GA (1:100) ...
-
bioRxiv - Cell Biology 2021Quote: ... E8-defined medium (Life Technologies, Carlsbad, CA, USA) or α-mem supplemented with 10% PL (depending on the experiment ...
-
bioRxiv - Bioengineering 2020Quote: ... RNA was isolated via Trizol (Invitrogen, Carlsbad, CA), and cDNA was synthesized using the RT2 First Strand Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2020Quote: ... 800µl TRIzol Reagent (Life Technologies, Carlsbad, CA, USA) was added and samples were stored at −80°C.
-
bioRxiv - Cancer Biology 2022Quote: ... and 1% penicillin/streptomycin (Life Technologies, Carlsbad, CA). The TNBC cell lines BT549 and Hs578T were cultured in α-MEM medium supplemented as above and with 1 μ/mL hydrocortisone and 12.5 ng/mL epidermal growth factor (Millipore Sigma ...
-
bioRxiv - Molecular Biology 2023Quote: ... and DAPI were purchased from Invitrogen (Carlsbad, CA). Normal rabbit IgGs were purchased from Agilent (Santa Clara ...
-
bioRxiv - Immunology 2022Quote: ... ECL Prime Substrate (Thermo Fisher Scientific, Carlsbad, CA) or Clarity Western (Bio-Rad ...
-
bioRxiv - Genomics 2022Quote: ... on a Qubit instrument (Life Technologies, Carlsbad, CA). A genomic DNA library was constructed for each individual mosquito using 20 ng DNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1% penicillin and streptomycin (Life Technologies, Carlsbad, CA). Astrocytes (ScienCell #1800 ...
-
bioRxiv - Cell Biology 2022Quote: ... BrdU (Life Technologies, Carlsbad, CA, Cat. No. 000103) was i.p ...
-
bioRxiv - Developmental Biology 2023Quote: ... 400 µl of TRIzol Reagent (Ambion, Carlsbad, CA) was utilized ...
-
bioRxiv - Developmental Biology 2023Quote: ... and SYTOX nuclear staining (Life Technologies, Carlsbad, CA) were used for detection ...
-
bioRxiv - Biochemistry 2023Quote: ... in pyridine (CAS#25104, Thermo scientific, Rockford, IL) and stirred at 90 ° C for 1.5 hours ...
-
bioRxiv - Microbiology 2023Quote: ... 5 U DNA polymerase (Invitrogen, Carlsbad, CA, USA), 0.2mM dNTPs (Invitrogen) ...
-
bioRxiv - Physiology 2023Quote: ... and SLC25a20 from Applied Biosystems (Foster City, CA). The relative fluorescence signal was normalized to PPIB using the ddCT method59.
-
bioRxiv - Genomics 2023Quote: Total RNA was extracted using TRIzol (Invitrogen, CA) (Chen et al. ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... or a combination of Trizol (Life Technologies, CA) and Qiagen RNeasy Mini kit (Qiagen ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and quantified on the NanoDrop (Thermo Fisher, CA). Target and control ...
-
bioRxiv - Microbiology 2023Quote: ... goat anti-rabbit IgG HRP (Invitrogen, CA# 31480), and goat anti-rabbit IgG Alexa Fluor Plus 800 (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... sodium pyruvate (1mM final concentration; Invitrogen, Carlsbad, CA), MEM non-essential amino acids (0.1mM final concentration ...
-
bioRxiv - Microbiology 2023Quote: ... 1X HALT protease inhibitor cocktail (Invitrogen, Carlsbad, CA)] buffer ...
-
bioRxiv - Developmental Biology 2023Quote: ... the PureLink RNA Mini Kit (Invitrogen, Carlsbad, CA) was used ...
-
bioRxiv - Immunology 2023Quote: ... followed by transfection with Lipofectamine CRISPRMAX Cas (Invitrogen), TrueCut Cas9 Protein v2 (Invitrogen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Superscript III Reverse Transcriptase (Life Technologies, Carlsbad, CA) was used to produce cDNA ...
-
bioRxiv - Biochemistry 2023Quote: ... Sytox Green (SG) was from Invitrogen (Carlsbad, CA). All other materials were from commercial sources and were analytical grade or better.
-
bioRxiv - Biochemistry 2023Quote: ... were purchased from Life Technologies (Carlsbad, CA, USA). Proteins were added to PC:PE (1:1 ...
-
bioRxiv - Neuroscience 2022Quote: ... 330nl of conjugated CTB (Life Technologies, Carlsbad, CA) was injected into the prefrontal cortex (PFC ...
-
bioRxiv - Neuroscience 2022Quote: ... and Alexafluor 488 (Life Technologies, Carlsbad, CA, USA) were included in the intracellular solution used in current clamp experiments ...
-
bioRxiv - Neuroscience 2022Quote: ... After mounting with ProLong Gold (Invitrogen, CA, USA), imaging was performed using the Axio Scan.Z1 (Zeiss ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1% antibiotic/antimycotic (Invitrogen, Carlsbad, CA, USA) and cultured overnight at 37 °C and 5% CO2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Lipofectamine 2000 was from Invitrogen (Carlsbad, CA, USA). The Chemiluminescence Western blot detection reagent was from Thermo Fisher Scientific (Waltham ...