Labshake search
Citations for Thermo Fisher :
3701 - 3750 of 10000+ citations for 6 Benzothiazolamine 2 1 methylpropyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... 1-2 µg total RNA was reverse transcribed using SuperScript IV VILO Master Mix with ezDNase Enzyme (Invitrogen) into cDNA ...
-
bioRxiv - Cell Biology 2021Quote: ... Coverslips were rinsed 2 x in DI water before mounting onto 1 mm-thick glass slides (Thermo Scientific) using anti-fade mounting medium (Dako).
-
bioRxiv - Cell Biology 2021Quote: ... 1:1000) for 2 hrs and then washed 3X in PBS before mounting with Prolong Diamond (Life Technologies).
-
bioRxiv - Neuroscience 2021Quote: The scrambled siRNA or the specific VEGFR siRNA (VEGFR-1-VEGFR-2 siRNA, Ambion Life Technologies, Monza, Italy) were intrathecally (i.t. ...
-
bioRxiv - Neuroscience 2021Quote: The scrambled siRNA or the specific VEGFR siRNA (VEGFR-1-VEGFR-2 siRNA, Ambion Life Technologies, Monza, Italy) were intrathecally (i.t. ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were resuspended (2.25 x 107cells/1.5mL) in DMEM/F12 supplemented with 1% penicillin-streptomycin and 2% B27 (all from ThermoFisher) and transduced overnight with a TdTomato-lentivirus in a 2ml tube using an Intelli-Mixer RM-2L (Dutcher) ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by 2 hours of incubation in blocking solution containing anti-chicken Alexafluor488 (1:400; Life Technologies A11039) and anti-goat Alexafluor594 (1:1000 ...
-
bioRxiv - Neuroscience 2021Quote: ... then split for 1) propagation and 2) screening by Sanger sequencing using a 3730xl DNA Analyzer (Applied Biosystems). Colonies positive for the target edit and without other changes in the immediate vicinity (within 300-400 bp ...
-
bioRxiv - Molecular Biology 2021Quote: ... and diluted to 1-2 million cells/mL using a Countess™ Automated cell counter (Invitrogen; Carlsbad, CA). On each day of experiments ...
-
bioRxiv - Cell Biology 2019Quote: ... rat monoclonal anti-α-tubulin (YL1/2; 1:1000 for IF; Cat#MA1-80017, Thermo Fisher, Waltham, MA), FITC-conjugated α-tubulin (DM1A ...
-
bioRxiv - Immunology 2020Quote: ... Anti-SARS-CoV-2 Coronavirus Spike protein (subunit 1) polyclonal antibody was purchased from Invitrogen (Carlsbad, CA, USA). Anti-SARS-CoV-2 Spike RBD rabbit polyclonal antibody was purchased from SinoBiological (Beijing ...
-
bioRxiv - Microbiology 2021Quote: ... and anti-SARS-CoV-2 spike protein (RBD) polyclonal antibody (RBD, 1:1,000, Invitrogen cat. no. PA5-114451). All primary antibodies were diluted in PBST + 5% milk and applied to membranes for ≥16 hours at 4 °C ...
-
bioRxiv - Immunology 2021Quote: ... Treated serum was then serially diluted 1 in 2 with PBS in 96 well v-bottom plates (Nunc) in 50 μL volumes ...
-
bioRxiv - Immunology 2020Quote: ... and lymphocytes were resuspended in complete RPMI (cRPMI- RPMI + 10% FCS + 2% Penicillin-Streptomycin + 1% L-glutamine (Gibco)) ...
-
bioRxiv - Genetics 2019Quote: ... The secondary antibodies used were (all from Life Technologies/Thermo Fisher Scientific; diluted 1:500 in 2% BSA): anti-guinea pig IgG Alexa Fluor 647 ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 mg of cell lysate was immunoprecipitated with 2 μg of anti-PODXL antibody (3D3, Thermo Fisher Scientific) overnight at 4ºC with rotation ...
-
bioRxiv - Cell Biology 2022Quote: ... 1-2 μg RNA was then converted to cDNA using high-capacity cDNA reverse transcription kits (Applied Biosystems). cDNA (1 ng/μL ...
-
bioRxiv - Genetics 2022Quote: ... or 2 ml of DMEM 5.56 mM low glucose (Thermo Fisher # 11885-084 with 1 mM sodium pyruvate). Both synchronization-release medium formulations were pre-warmed and each contained ...
-
bioRxiv - Immunology 2022Quote: ... PTBP1-RNA complexes were precipitated with 2 µg of anti-PTBP1 antibody (ThermoFisher clone 1 cat#:32-4800) and 20 µl of Protein A/G beads (Pierce cat#:88802 ...
-
bioRxiv - Physiology 2022Quote: ... then incubated for 2 hours at room temperature in Alexa Fluor fluorescent secondary antibody (Life Technologies; 1:500) prepared in blocking solution ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1/2 peptide were separated and analyzed with a Nano-HPLC (EASY-nLC1200, Thermo Fisher Scientific, Inc., USA) coupled to Q-Exactive MS (Thermo-Fisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... for 2 days and Neurobasal/B27 medium (Neurobasal Medium, Thermo Fisher Scientific; supplemented with 1× B27, Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... iPSCs were transfected with PB-TO-hNGN2 vector in a 1:2 ratio (transposase:vector) using Lipofectamine Stem (Invitrogen), then selected after 24-48 hrs for 3 to 14 days with 8 µg/mL of puromycin (Sigma-Aldrich).
-
bioRxiv - Bioengineering 2022Quote: ... in IMDM/F12 medium supplemented with 1% (v/v) N-2 (Thermo Fisher Scientific, catalogue no. 17502-048), 1% (v/v ...
-
bioRxiv - Microbiology 2024Quote: ... 1.5 mL of pre-warmed plaquing medium made of DMEM-2% NBCS-1% Antibiotic-Antimycotic 100X (Invitrogen, # 15240062) was added per well ...
-
bioRxiv - Genomics 2024Quote: ... ERCC Mix 1 or Mix 2 spike-ins were randomly added to each sample (Thermo Fisher, catalog #4456740) before pooling and sequencing on Illumina NovaSeq S4 to an average depth of 50 million paired-end reads per sample as previously described95 ...
-
bioRxiv - Immunology 2024Quote: ... and supplemented with 1µg/mL of L-1-tosylamido-2-phenylethyl chloromethyl ketone (TPCK)-treated trypsin (Thermo Fisher) was added into each well ...
-
bioRxiv - Microbiology 2024Quote: ... paramagnetic beads were washed three times with 1X wash buffer (50 mM Tris-HCl pH 7.5 – 150 mM sodium chloride – 0.05% Tween-20 – 1 mM dithiothreitol) using DynaMag-2 magnetic stand (Invitrogen). Mpro-Avi (6 ug ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA was made from 1-2 µg of total RNA using the first strand cDNA synthesis kit (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... or with Protein A agarose beads incubated with 2 μg anti-LONP1 antibody (ThermoFisher Scientific 15440-1-AP) overnight (16 hours ...
-
bioRxiv - Neuroscience 2022Quote: ... or Alexa 647-labeled species-specific secondary antibodies for 2 hr at a dilution of 1:200 (Invitrogen; Jackson ImmunoResearch ...
-
bioRxiv - Immunology 2022Quote: ... incubating for 2 hrs at ambient temperature with Alexa Fluor donkey anti-Rabbit 555 1:200 (A31572, Invitrogen), DAPI for 5 minutes and then cover slipping the tissue sections with Aqua-Poly mount (Polysciences) ...
-
bioRxiv - Microbiology 2023Quote: ... parasite nuclei were visualized by incubating samples with 1-2 μg/mL Hoechst 33342 (Thermo Scientific Pierce 62249) for 10-20 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... were blocked for 2 hr at 4 °C in lysis buffer containing 1 mg/ml yeast tRNA (Ambion) and washed twice with 1 ml lysis buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... From D4 on N2/B27 (Neurobasal medium/GLUTAMAX/2% B27 w/o vitamin A [Gibco]/1% N2 [Gibco] was added to the KSR medium every second day in increments of 25% ...
-
bioRxiv - Cancer Biology 2023Quote: ... organoids were passaged every 1-2 weeks by incubating organoids for 5-10 min in TrypLE Express (Gibco) at 37℃ and mechanical disruption to make organoids fall apart ...
-
bioRxiv - Developmental Biology 2023Quote: ... Bones were flushed using a 26-gauge needle of a 1-ml syringe with HBSS+2% FCS (Gibco). BM clumps were re-suspended by gentling aspirating with a 19-gauge needle ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated for 1 h in anti-HA 2-2.2.14 IgG1 mouse mAb (ThermoFisher Catalog# 26183; RRID:AB_10978021) diluted 1:2000 and following 3 x 10 min washes in 0.1 M PB ...
-
bioRxiv - Microbiology 2023Quote: ... with 100 µL cell suspension at the density of 2×105 cells mL-1 in Dulbecco’s modified Eagle’s medium (DMEM) (GIBCO) supplemented with 10% (v/v ...
-
bioRxiv - Physiology 2023Quote: ... containing 1% Triton X-100 and 2% Halt Protease and Phosphatase Inhibitor Cocktail (Thermo Scientific, Waltham, MA, USA). Lysates were sonicated and centrifuged ...
-
bioRxiv - Physiology 2023Quote: ... sections were incubated 2 h at RT with A568 donkey anti-rabbit secondary antibody (1:500; Invitrogen; A10042) in [PB 0.2% Tx + 1% donkey serum] ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... sheared into pieces 1–2 kb in size and cloned using the TOPO Shotgun Subcloning Kit from Invitrogen. Colonies containing inserts were collected ...
-
bioRxiv - Immunology 2023Quote: ... BA.1 or BA.2 expression vectors (pcDNA3.1_ spike_del19) using Expifectamine Enhancer according to the manufacturer’s protocol (Thermo Fisher). Two days later ...
-
bioRxiv - Immunology 2023Quote: ... This step was followed by 2 hours incubation in Alexa Fluor anti-rabbit 488 (1:350, Life Technologies) and horse anti-mouse biotinylated (1:350 Life Technologies) ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... Odour dilutions (10-2 for butanol and 10-1 linalool) in mineral oil (Acros Organics, product code: 124020010) were chosen due to their overall similar strength of response in the cockroach antennal lobe (Paoli et al ...
-
bioRxiv - Cancer Biology 2023Quote: ... and sub cultured by incubation for 2 minutes in 1 ml of 0.25% Trypsin-0.53mM EDTA (Gibco, 25200072) at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA was synthesized from 1~2 μg of RNA using Superscript IV VILO master mix (Thermo Fisher #11756050). The cDNA was diluted 3-fold and 1 μl of diluted cDNA was used as template ...
-
bioRxiv - Microbiology 2023Quote: ... Complexes were precipitated by centrifugation and washed three times in PBS supplemented 0.02% Tween 20 and resuspended in 100 uL PBS prior to elution with 40 uL of 2 parts 0.1M glycine pH 2.8 and 1 part NuPage sample buffer and reducing agent (Invitrogen). Samples were heated at 70°C for 10 min prior to magnetic removal of Dynabeads and storage at -20°C.
-
bioRxiv - Cell Biology 2023Quote: ... 1:2 diluted whole cell extract in buffer C was added to Dynabeads Protein G (Thermo Fisher Scientific) pre-incubated with HEXIM1 antibody ...