Labshake search
Citations for Thermo Fisher :
3651 - 3700 of 10000+ citations for hsa mir 23b Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... was used in conjunction with a PCR machine model ABI StepOne Plus Real-time PCR (Applied Biosystems). The experiment was repeated 3 times and unpaired Student’s t-test was used to compare the study groups.
-
bioRxiv - Cancer Biology 2019Quote: ... was used to perform qRT-PCR in the 7500 Fast Real-Time PCR instrument (Applied Biosystems, USA). Fold change values (2−ΔΔCT ...
-
bioRxiv - Genomics 2021Quote: ... Real Time PCR was performed using the SYBR green PCR master mix (Applied Biosystems, Foster City, CA) and an 7900HT sequence detection system (Applied Biosystems) ...
-
bioRxiv - Evolutionary Biology 2020Quote: cDNA was PCR-amplified with the StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) using SsoAdvanced™ Universal SYBR® Green Supermix (Biorad ...
-
bioRxiv - Cancer Biology 2021Quote: ... Quantitative Real time PCR (qRT- PCR) was performed using the Power SYBR Green Master Mix (Life Technologies). Cycling conditions were as follows ...
-
bioRxiv - Bioengineering 2021Quote: ... Quantitative PCR (qPCR) was performed using Applied Biosystems® QuantStudioTM 3 Real-Time PCR System (ThermoFisher Scientific) with either SYBR® Green or TaqMan® probes ...
-
bioRxiv - Cell Biology 2021Quote: ... and quantitative real-time PCR was performed using TaqMan Universal PCR Master Mix (Applied Biosystems, cat# 4305719) and TaqMan Real-time PCR Assays for specific genes listed below.
-
bioRxiv - Cancer Biology 2020Quote: ... cDNAs were quantified by real-time PCR using a SYBR® Green PCR Master Mix (Applied Biosystems) on a ABI Prism® 7000 (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2020Quote: ... Real-time PCR was performed on the cDNA using the Platinum SYBR Green PCR Master Mix (Invitrogen) on the ABI Prism 7900HT Detection System (Life Technologies ...
-
bioRxiv - Plant Biology 2020Quote: ... qRT-PCR was performed on a QuantStudio 1 Real-Time PCR System (Applied BiosystemsTM, Thermo Fisher Scientific) using the Applied BiosystemsTM PowerUpTM SYBRTM Green Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2020Quote: ... PCR amplification was performed with a QuantStudio™ 6 Flex Real-Time PCR System (Thermo Fisher Scientific) in 20-μl reactions using 1 μl of cDNA (10 ng of total input RNA) ...
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR was carried out in a QuantStudio™ 12K Flex Real-Time PCR System (Applied Biosystems). Each reaction contained 25 ng transcribed cDNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR reactions were performed using the Step one Plus™ Real-Time PCR system (Applied Biosystems, USA), and ΔΔCt method was used to determine the relative mRNA quantification (Sharma et al ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative real-time PCR (qRT-PCR) was performed using gene specific primers and SYBR Green (Life Technologies) on the LightCycler® 480 Instrument II (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... Real-time quantitative PCR (qPCR) was performed using Power SYBR green PCR master mix reagents (Applied Biosystems) on a ViiA7 real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2020Quote: ... qRT-PCR reactions were carried out on an ABI 9700 Real-time PCR system (Applied Biosystems Instrument), the cycling protocol and the primers as follows ...
-
bioRxiv - Cancer Biology 2020Quote: ... All qRT-PCR was performed on a QuantStudio 3 Real-Time PCR system and software (Applied Biosystems). GAPDH or 18s were used as reference genes ...
-
bioRxiv - Cancer Biology 2021Quote: ... Real-time quantitative PCR was performed using the POWER SYBR Green PCR Master Mix (Applied Biosystems, #4367659) to measure expression levels of GUSB ...
-
bioRxiv - Neuroscience 2022Quote: Real-time quantitative PCR was carried out on a QuantStudio™ 12K Flex PCR system (Applied Biosystems) using TaqMan miRNA assays (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2022Quote: ... qRT-PCR was performed on a Step One Plus Real-Time PCR System (Thermo Fisher, Cat#42765592R) using QuantiTect SYBR Green PCR Kit (Qiagen ...
-
bioRxiv - Developmental Biology 2022Quote: ... qRT-PCR was performed on a Step One Plus Real-Time PCR System (Thermo Fisher, Cat#42765592R) using QuantiTect SYBR Green PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... was used to catalyze PCR in a QuantStudio 3 Real-Time PCR System Machine (Applied Biosystems, A28567). Amplification data was produced with QuantStudio Design and Analysis software.
-
bioRxiv - Neuroscience 2021Quote: qRT-PCR was performed on an ABI 7500 Real-Time PCR System (Applied Biosystems, Foster city, CA) using iQ SYBR® Green Supermix from Bio-Rad ...
-
bioRxiv - Immunology 2021Quote: ... Real time quantitative PCR was performed using a Power Syber green PCR master Mix (Fisher Thermo Scientific) on a Light Cycler 480 (Roche) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... qRT-PCR was carried out on a real-time PCR system (Thermo Fisher Scientific; QuantiStudio 7 Flex) using the following conditions ...
-
bioRxiv - Microbiology 2021Quote: ... and then run for quantitative PCR assays on the StepOnePlus™ Real-Time PCR System (Applied Biosystems) with the Power SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real-time PCR was subsequently performed with cDNA using a universal PCR Master Mix (Thermo Fisher Scientific). The data were collected and analyzed using a StepOne Real-Time PCR System and StepOne Software v2.3 (Thermo Fisher Scientific) ...
-
bioRxiv - Plant Biology 2020Quote: ... The qRT-PCR was performed using a StepOne Plus Real-Time PCR Thermo-cycler (Fisher Scientific, Canada), with an initial GoTaq® Hot Start Polymerase activation step at 95 °C for 2 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... and subjected to quantitative real-time PCR with the Power SYBR Green PCR Master Mix (Thermo Scientific) on StepOnePlus Real-Time PCR System (Thermo Scientific) ...
-
Cryptococcus neoformans secretes small molecules that inhibit IL-1β inflammasome-dependent secretionbioRxiv - Immunology 2019Quote: ... qRT-PCR was performed using SyBr Green Master Mix and StepOne real-time PCR system (Applied Biosystems). The primer sequences were as follows ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... A quantitative PCR was performed on a PikoReal 96 Real-Time PCR machine (Thermo Fisher Scientific TCR0096) using 0.2 % of the unamplified library and the following thermal profile ...
-
bioRxiv - Cell Biology 2020Quote: ... and 7900HT Fast Real-Time PCR System (Applied Biosystem) using SYBR Green PCR Master Mix (Life Technologies) and gene-specific primers ...
-
bioRxiv - Biochemistry 2021Quote: ... Quantitative PCR was performed according to manufacturer’s specifications on a StepOnePlus Real-Time PCR System (Thermo Fisher) using PerfeCTa® SYBR® Green SuperMix (Quantabio ...
-
bioRxiv - Molecular Biology 2021Quote: ... The cDNAs were subjected to quantitative real-time PCR using SYBR Green PCR master mix (Applied Biosystems) and ViiA 7 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Genetics 2021Quote: ... and Real-time PCR reactions were performed using the Power SYBR Green PCR Master Mix (Applied Biosystems) on the 7900HT Fast Real Time PCR System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative real-time PCR (qRT-PCR) was carried out using SYBR green master mix (Applied Biosystems™) in a StepOne Plus thermal cycler (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Quantitative reverse transcription gene amplifications (qRT-PCR) were performed with StepOnePlus Real-Time PCR System (Applied Biosystems) using the Power SYBR Green PCR Master Mix (Applied Biosystems) ...
-
bioRxiv - Immunology 2021Quote: ... ChIP-DNA underwent qRT-PCR using a TaqMan® 7900HT Fast Real-Time PCR System (Applied Biosystems) per manufacturer’s recommendations ...
-
bioRxiv - Immunology 2021Quote: ... and quantitatively detected by real-time PCR using the TaqMan® Universal PCR Master Mix (Life Technologies) with primers (forward primer - 5’ CCCATGTTTTCAGCATTATCAGAA 3’ and reverse primer-5’ CCACTGTGTTTAGCATGGTGTTTAA 3’ ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative PCR (qPCR) analysis was performed using an Applied Biosystems 7500 Fast Real-Time PCR system (ThermoFisher) and Brilliant II SYBR Green Master Mix (600830 ...
-
bioRxiv - Immunology 2021Quote: ... All qRT-PCR assays were performed on QuantStudio™ 3 Real-Time PCR System (Thermo Fisher®).
-
bioRxiv - Developmental Biology 2022Quote: Quantitative PCR (qPCR) analysis was carried out on a StepOnePlus™ Real-Time PCR System (Life Technologies) using Power SYBR® Green PCR Master Mix (Promega #A6002) ...
-
bioRxiv - Microbiology 2022Quote: ... Quantitative PCR (qPCR) analysis was conducted using a QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems). A ...
-
bioRxiv - Bioengineering 2022Quote: ... Quantitative real-time PCR (qPCR) was then performed using SYBR Green PCR Master Mix (#4309155; Thermo Fisher) with the LightCycler® 480 device (Roche) ...
-
bioRxiv - Bioengineering 2022Quote: ... Real-time quantitative PCR (qPCR) was performed using the SYBR Green PCR Master Mix (Applied Biosystems, 4309155). Primer sequences ...
-
bioRxiv - Biochemistry 2022Quote: ... Quantitative real-time PCR was performed using Power SYBR® Green PCR Master Mix (Applied Biosystems, 4368577) and PCRs were performed in a QuantStudio 5 cycler (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2022Quote: Quantitative PCR (qPCR) analysis was carried out on a StepOnePlus™ Real-Time PCR System (Life Technologies) using Fast SYBR™ Green Master Mix (ThermoFisher Scientific #4385612) ...
-
bioRxiv - Neuroscience 2024Quote: ... Quantitative real-time PCR (qRT-PCR) was carried out using ViiA (Applied Biosystems, Foster City, CA, USA). Reactions were run in triplicate and expression of each gene were normalized to the geometric mean of GAPDH as a housekeeping gene and analyzed by using the ΔΔCT method ...
-
bioRxiv - Microbiology 2024Quote: Reverse transcription quantitative PCR analysis was performed on QuantStudio 5 Real-Time PCR system (Thermo Scientific, USA) using the primer set from E or RdRp Charité (IDT Coralville ...
-
bioRxiv - Neuroscience 2024Quote: ... Quantitative PCR (qPCR) was performed using a QuantStudio™ 12K Flex Real-time PCR System (Applied Biosystems) and a QuantStudio™ 7K Flex Real-time PCR System (Applied Biosystems) ...