Labshake search
Citations for Thermo Fisher :
3651 - 3700 of 10000+ citations for 6 Methoxyquinoline 3 carboxaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... on the QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific) with standard protocol ...
-
bioRxiv - Microbiology 2022Quote: ... qPCR was performed using a QuantStudio 3 (Applied Biosystems, Waltham, MA) with the following conditions ...
-
bioRxiv - Neuroscience 2022Quote: ... and the [4– 3] destination vector (pCFJ201) using LR clonase (Invitrogen). Plasmids were inserted into the worm genome as a single copy using the MosSCI technique (Frøkjaer-Jensen et al. ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: human TASK-3 was overexpressed by transient transfection (Lipofectamine 2000 (Invitrogen)) into a HEK293 cell line stably expressing AMPK-β-1S108A mutant subunit ...
-
bioRxiv - Molecular Biology 2022Quote: ... IP samples were analyzed on 3–8% tris-glycine gels (Invitrogen). Additionally ...
-
bioRxiv - Molecular Biology 2022Quote: ... Indole-3-acetic acid (IAA) was purchased from ThermoFisher (Product #I3750). IAA treatment was performed as previously described (Zhang et al ...
-
bioRxiv - Developmental Biology 2022Quote: ... and QuantStudio™ 3 Real-Time PCR System (Applied Biosystems A28567). All primers used in qRT-PCR had primer efficiencies above 98% ...
-
bioRxiv - Cell Biology 2022Quote: ... and passaged every 3-4 days with 0.05% Trypsin-EDTA (Gibco), and after a few passages ...
-
bioRxiv - Cell Biology 2022Quote: ... and passaged every 3-4 days with 0.25% Trypsin-EDTA (Gibco).
-
bioRxiv - Synthetic Biology 2024Quote: ... pH 8.3) and 3 µL of SYBR safe (Thermo Fisher Scientific). Gels were run at 70 V for approximately 2-3 hrs at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... and run on the QuantStudio 3 system (Applied Biosystems, Waltham, Massachusetts). Human 18S rRNA was used as the housekeeping gene for normalization ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated with TO-PRO™-3 Iodide (Invitrogen, UK) for 15 min and mounted using ProLong Glass Antifade Mountant (Thermo Fisher ...
-
bioRxiv - Neuroscience 2024Quote: ... Assays were run on the QuantStudio 3 PCR system (Applied Biosystems). To ensure results included all Kcnq2 and Kcnq3 splice isoforms (Pan et al. ...
-
bioRxiv - Biochemistry 2024Quote: ... A405 measurements were taken in a spectrophotometer (BioMate 3, Thermo Fisher) for 5 min with 1 min intervals ...
-
bioRxiv - Developmental Biology 2024Quote: ... DNA was labeled with ToPro-3 (1:5000; Invitrogen, Cat #T3605) in 0.3% PBST for 30 min at RT ...
-
bioRxiv - Physiology 2024Quote: ... and on a QuantStudio 3 Real-Time PCR System (Applied Biosystems). The primers were all purchased from Millipore Sigma with sequences listed as below ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 5’- TTGGATCAGCTCAGACATATT-3’ or a nonspecific “scrambled” control (Invitrogen, United States). 72 hours after transfection ...
-
bioRxiv - Biochemistry 2024Quote: ... column (Betasil C18, 100 × 2.1 mm, 3 µm particle; Thermo Scientific) was washed with 100 mL of Solvent B (MeOH ...
-
bioRxiv - Microbiology 2024Quote: ... or a QuantStudio 3 (Thermo Fisher Scientific, Inc., Waltham, MA, U.S.A.) with two primers and probes consisting of the forward primer (5’-TGC TCA TGG TAT CAA TCT TAT CG −3’) ...
-
bioRxiv - Microbiology 2024Quote: ... PCR products were detected using a QuantStudio 3 (Thermo Fisher Scientific) qPCR machine ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were fixed in 3% paraformaldehyde (PFA; #043368.9M, Thermo Fisher Scientific) for 10 min at room temperature (RT ...
-
bioRxiv - Cell Biology 2024Quote: ... Fast DiI (1,1′-dilinoleyl-3,3,3′,3′-tetramethylindocarbocyanine, 4-chlorobenzenesulphonate, D7756, Invitrogen) to back label parasympathetic preganglionic neurons (PPNs ...
-
bioRxiv - Cell Biology 2024Quote: ... organoids were washed 3 times with ice-cold PBS (Gibco, #14190250) and kept on ice for the entire isolation procedure ...
-
bioRxiv - Microbiology 2024Quote: ... The qPCR reactions were run on a QuantStudio 3 (Applied Biosystems). The data were normalized using a standard curve from gDNA extracted from purified EBs.
-
bioRxiv - Immunology 2024Quote: ... were coated with 3 µg ml-1 of streptavidin (Thermo Fisher) diluted in carbonate-bicarbonate buffer (E107 ...
-
bioRxiv - Genetics 2023Quote: ... cells were counted with Countess 3 Automated Cell Counter (Thermo Fisher) and around 100,000 cells were allotted into a fresh 1.5 mL tube and centrifuged at 500 g for 10 min at 4℃ ...
-
bioRxiv - Microbiology 2023Quote: ... The first method was staining with DiIC12(3) dye (Thermo Fisher). Five milliliters of overnight B ...
-
bioRxiv - Developmental Biology 2024Quote: ... on a QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific). Primer sequences are indicated in Appendix Table 2 ...
-
bioRxiv - Plant Biology 2023Quote: ... on a QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific). The data were normalized using actin (Solyc11g005330 ...
-
bioRxiv - Cancer Biology 2024Quote: ... via cytocentrifugation on a Shandon Cytospin 3 Cytocentrifuge (Thermo Fisher Scientific) at 500g for 5 minutes ...
-
bioRxiv - Immunology 2024Quote: ... cells were washed 3 times with PBS (Gibco Life Technologies,10010) for 5 min ...
-
bioRxiv - Immunology 2024Quote: ... cells were washed 3 times with PBS (Gibco Life Technologies,10010) for 5 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were run on NuPAGE 3-8% Tris Acetate Gel (Invitrogen) in Tris-Acetate SDS Running Buffer (Novex) ...
-
bioRxiv - Genetics 2024Quote: ... and QuantStudio™ 3 Real-Time PCR System (Thermo Fisher Scientific). Primers for amplifying mtDNA were AGCTCATCATATATTTACCGTTGGA & AGCTGGAGAATAAGAAA-GTTGAGT ...
-
bioRxiv - Immunology 2024Quote: ... CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher, C10423) was added to cultures at 20 μM and incubated for 30 min at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... and plates were blocked with 3% non-fat milk (Life Technologies) diluted in PBS containing 0.01% Tween-20 (PBST ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μg/ml anti-CD3 (Thermo Fisher Scientific, 16-0032-82) and 5 μg/ ml anti-CD28 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by 3 PBS washes and mounting using ProLong Gold (Invitrogen) and 18mm square glass coverslips ...
-
bioRxiv - Cell Biology 2024Quote: ... and 3% THE RNA Storage Solution (Thermo Fisher Scientific, Cat # AM7001) dissolved entirely in molecular H2O ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were passaged every 3-4 days with TrypLE (12604013, Gibco). Cells were authenticated by STR and tested for mycoplasma annually through Genetica Inc a subdivision of LabCorp.
-
bioRxiv - Biochemistry 2023Quote: ... Cas9 was diluted to 3 µM with Opti-Mem (ThermoFisher Scientific) and sgRNAs were diluted to 3 µM with TE buffer (Synthego Inc) ...
-
bioRxiv - Genomics 2022Quote: ... at a 1:3 ratio in Opti-MEM medium (Gibco, 11524456), incubated for 15 minutes at room temperature and added dropwise to the cells ...
-
bioRxiv - Microbiology 2023Quote: ... AmpB (3 mg/kg/d; diluted in sterile saline; AmpB; Gibco), PEA (0.5 mg/kg/d ...
-
bioRxiv - Genomics 2023Quote: ... Quality check of HMW DNA included fluorometric (Qubit v.3, Invitrogen) quantification of concentration ...
-
bioRxiv - Systems Biology 2023Quote: ... The supernatant was mixed with 3 µL GlycoBlue co-precipitant (Invitrogen), 1:10 volume of 3 M sodium acetate ...
-
bioRxiv - Neuroscience 2023Quote: ... and cultured for 3 days in DMEM/F12-Glutamax medium (Gibco) containing 1% N2 supplement (Gibco) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quantitative PCR was performed on the QuantStudio 3 instrument (Thermo Fisher), using SYBR Green PCR master mix (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Slides were incubated in 3% H2O2 (ThermoFisher Scientific; Catalog #H325-500) for 15 min to quench endogenous peroxidase activity ...
-
bioRxiv - Immunology 2023Quote: ... on a QuantStudio 3 Real-Time PCR System (Applied Biosystems, A28567). Primers for Nos2 and B2m were designed using NCBI PrimerBlast84 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Afterwards 3 volumes of Trisol LS reagent (ThermoFisher Scientific, 10296-028) was added ...