Labshake search
Citations for Thermo Fisher :
3551 - 3600 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... and cDNA was synthesized using High Capacity cDNA Reverse Transcription kits (Applied Biosystems, Waltham, MA) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: Reverse transcription was carried out using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) according to the manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2024Quote: ... polyadenylated mRNA using T3 mMessage mMachine High Yield Capped RNA transcription kit (ThermoFisher AM 1348). Tol2 mRNA was purified using the ZYMO RNA Clean & Concentrator-5 kit (ZYMO R1015 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and reversed transcribed using the High-Capacity cDNA Reverse Transcriptase Kit (Applied Biosystems, Cat# 4368814). Gene specific primers containing a T7 promoter sequence were designed for Wnt11 (Forward ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The single-stranded cDNA was synthesized using the High-Capacity cDNA Reverse Transcription Kit (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... and then converted to cDNA using the High- Capacity cDNA Reverse Transcription kit (Applied Biosystems). Primers were ordered from Integrated DNA Technologies and qPCR was performed using 2X qPCR master mix (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... complementary DNA (cDNA) was synthesized with High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, 4368814) and analyzed by qPCR with Fast SYBR Green Master Mix and StepOnePlus Real-Time PCR System ...
-
bioRxiv - Molecular Biology 2024Quote: RNA samples were converted to cDNA using High-Capacity RNA-to-cDNA Kit (Applied Biosystems). Quantitative PCR reactions were performed using the iTaq Universal SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: ... To measure IL-10 serum levels the IL-10 Monkey ELISA Kit (Thermo Fisher, Waltham) was used according to the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2020Quote: ... Embryos were cultured at density of 1 or 10 embryos in 10 μl KSOM medium (50) according to the experimental design in 60-well plates (LUX 5260, Nunc, Naperville, IL, USA) overlaid with 2 mm of heavy paraffin oil (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... For detection of effector caspase activity 20 µM CellEvent Caspase 3/7 Green Detection Reagent (ThermoFisher Scientific) was added to the infected cells prior to imaging ...
-
bioRxiv - Neuroscience 2023Quote: ... 30 microliters of the apoptosis detection reagent (CellEvent™ Caspase-3/7 Green Detection Reagent, Thermofisher, C10723) was added to each well and the slide returned to the incubator for another 60 minutes ...
-
bioRxiv - Bioengineering 2020Quote: ... high glucose (Gibco) supplemented with 10% FBS and 1X Antibiotic-Antimycotic ...
-
bioRxiv - Biochemistry 2020Quote: ... high glucose (Gibco) containing 10% fetal bovine serum (Life Sciences) ...
-
bioRxiv - Biochemistry 2022Quote: ... high glucose (Gibco) with the addition of 10% Fetal Bovine Serum (Gibco) ...
-
bioRxiv - Neuroscience 2021Quote: ... high glucose (GIBCO), half OptiMEM 1 (Gibco ...
-
bioRxiv - Biochemistry 2021Quote: ... high glucose (Gibco)] supplemented with 10% (v/v ...
-
bioRxiv - Microbiology 2020Quote: ... High Fidelity (ThermoFisher) and purified using Qiagen PCR purification or Qiagen Gel extraction kits.
-
bioRxiv - Bioengineering 2021Quote: ... high glucose (Gibco) supplemented with 10% FBS and 1X Antibiotic-Antimycotic ...
-
bioRxiv - Biophysics 2019Quote: ... high glucose (Gibco) supplemented with 10% horse serum (CellGro) ...
-
bioRxiv - Neuroscience 2021Quote: ... high glucose (Gibco) with 5% serum and 1% Pen/Strep.
-
bioRxiv - Cell Biology 2020Quote: ... high glucose (Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Biochemistry 2022Quote: ... high glucose (Gibco) containing 10% fetal bovine serum (HyClone ...
-
bioRxiv - Cell Biology 2024Quote: ... high glucose (Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... High Fidelity (Invitrogen) and 10x AccuPrimeTM PCR Buffer II in combination with gene specific primers (at 10 µM each ...
-
bioRxiv - Cell Biology 2023Quote: ... high glucose (Gibco) supplemented with 10% FBS ...
-
bioRxiv - Microbiology 2024Quote: ... high glucose (Gibco) with 10% FBS and 10mM Hepes ...
-
bioRxiv - Genetics 2024Quote: ... high glucose (Gibco 11965084 ...
-
bioRxiv - Cell Biology 2020Quote: ... One µg of total RNA was retrotranscribed into complementary cDNA using an RT-PCR kit (High capacity cDNA rt Kit, Applied Biosystems). Quantitative PCRs were carried out in triplicate of each sample using 40 ng of cDNA per well ...
-
bioRxiv - Immunology 2021Quote: ... Total RNA was isolated using the RNeasy Micro kit and cDNA synthesized a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Targeted qPCR was performed using the QuantStudio 6 Real-Time PCR system using the following Taqman Primers (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2019Quote: ... total RNA was isolated using E.Z.N.A.® MicroElute Total RNA Kit (Omega Bio-tekkit) and transcribed into complementary DNA using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Real-time PCR reactions were carried out using 1x GoTaq™ qPCR Master Mix (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... Total RNA was extracted from iPSC cells using the NucleoSpin RNA kit (Machery-Nagel) and cDNA was synthesized using the High-Capacity cDNA Reverse Transcription Kit (Life Technologies). qRT-PCR was performed on all the TTLL/CCP fragments generated from primers designed in supplementary figure 5 and the housekeeping control GAPDH (GAPDHFOR 5′ − GAAGGTGAAGGTCGGAGT − 3′ and GAPDHREV 5′GAAGATGGTGATGGGATTTC − 3′).
-
bioRxiv - Immunology 2022Quote: ... or Single Cell RNA purification Kit (Norgen 51800) and reverse transcription was performed using a high-capacity cDNA reverse transcription kit (Applied Biosystems) by following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: Total RNA was isolated from cells by using a Qiagen RNeasy kit and then reverse transcribed to generate cDNA with the High Capacity cDNA kit (Applied Biosystems). Quantitative PCR was performed by using SYBR green (Quanta Biosciences ...
-
bioRxiv - Neuroscience 2022Quote: ... High-Capacity cDNA Reverse Transcription Kit and Mir-X™ miRNA First Strand Synthesis Kit were purchased from Applied Biosystems (USA) and Takara (China ...
-
bioRxiv - Cell Biology 2023Quote: RNAs extracted by either Trizol or RNeasy Plus Micro Kit were reverse transcribed to cDNAs using High-Capacity cDNA Reverse Transcription Kit (4368814; Applied Biosystems), and quantitative PCR was performed using DyNAmo Flash SYBR Green qPCR Kit (F415S ...
-
bioRxiv - Immunology 2023Quote: ... and cDNA was synthesized using PureLink™ RNA Mini Kit and High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher scientific, USA) respectively ...
-
bioRxiv - Neuroscience 2024Quote: ... Reverse transcription was performed on 1 ng of total RNA using a commercial kit (High Capacity RNA-to-cDNA Kit; Applied Biosystems) and Real-Time PCR amplification (CFX Opus 96 Real-Time PCR Instrument ...
-
bioRxiv - Microbiology 2019Quote: Spotted protein arrays (5 x 6) were printed onto each well of Greiner high-binding 96-well plates (Cat# 655097, Thermo Fisher Scientific) using a sciFLeXARRAYER S12 (Scienion AG ...
-
bioRxiv - Immunology 2021Quote: ... 50 μl serially diluted pMHC were added to each well of high-binding capacity streptavidin-coated 96-well plates (#15500; Thermo Fisher Scientific). After a minimum 45-min incubation at room temperature ...
-
bioRxiv - Developmental Biology 2022Quote: ... filter and seeded on Matrigel coated plates at a density of 60,000-100,000/cm2 in BCTFT medium [DMEM high glucose (Thermo Fisher Scientific, 11965-118) + Penicillin/Streptomycin (Life Technologies ...
-
bioRxiv - Immunology 2022Quote: ... and citrullinated Histone 4 using biotinylated peptides (Cit3-His4 bio: SG[Cit]GKGGKGLGKGGAKRHGSGSK-biotin) on streptavidin-coated high-capacity pre-blocked plates (Thermo Fisher Scientific) and hIgG1 at 5 μg/ml in RIA buffer (1% BSA ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mixed populations were seeded at 10,000 cells per well in a 12-well plate and imaged every 3 days for a total of 18 days using an ArrayScan Cellomics high content microscope (Thermo Fisher Scientific). HCS Studio Cell Analysis Software (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... E3.5 embryos were plated individually into gelatine-coated wells of 24-well plates in embryonic stem cell (ESC) medium (DMEM, high glucose 4500 mg/L (Gibco, ThermoFisher, #11965,), 100 µM 2-mercapto-ethanol (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... Bacteria from day two plates were resuspended in PBS and adjusted to an OD 600 nm of 0.5 to coat high binding ELISA plates (Nunc-Immuno™, ThermoScientific). After incubation overnight at 4ºC ...
-
bioRxiv - Bioengineering 2021Quote: ... The calibration beads allowed the detection of the MVs and EXOs using a 488/10 nm small particle side scatter filter (Invitrogen, Carlsbad, CA) on the BL1 channel and generate a size reference scale ...
-
bioRxiv - Molecular Biology 2021Quote: ... After incubation for 1 h at 37 °C the DNA products were analyzed by electrophoresis on a denaturing polyacrylamide gel (10%) and detected by chemiluminescent detection (Thermo Fisher Scientific). To semi-quantify the level of dCTP incorporation ...
-
bioRxiv - Synthetic Biology 2021Quote: ... protein residue level was below the minimum detection threshold of Micro BCA Protein Assay Kit (Thermo Fisher, Cat. # 23235), and no bacterial colonies formed in bioburden detection.
-
bioRxiv - Neuroscience 2021Quote: ... Labeling efficiency was determined by dot blotting using the chemiluminescent nucleic acid detection module kit (89880, Thermo Fisher scientific).
-
bioRxiv - Microbiology 2019Quote: ... The binding assays and detection of RNA products were performed with the LightShift Chemiluminescent RNA EMSA Kit (Thermo Scientific). For the control reactions ...