Labshake search
Citations for Thermo Fisher :
3451 - 3500 of 10000+ citations for Cortisol ELISA Kit 1 Strip plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: The Nunc MaxiSorp™ C-shaped Plates (Thermo Fisher) were coated with 2.5 µg/ml of DrSA/DiSA in 0.1 M sodium carbonate buffer (pH 9.5 ...
-
bioRxiv - Microbiology 2023Quote: ... and arrayed into 96-well plates by Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... MicroAmp Optical 96 Well Reaction Plates (Thermofisher, cat.#N8010560) were placed in a QuantStudio 3 (Thermofisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: Maxisorp 96 well microtiter plates (Thermo Fisher Scientific, NY) were coated with 8μg/ml of human neuropilin-1 (NRP-1 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... all cells were plated on 8-well plates (Nunc™ Rectangular Dishes ...
-
bioRxiv - Immunology 2023Quote: ... Nunc-Immuno MicroWell 96-well plates (Thermo Fisher Scientific) were coated with recombinant SARS-CoV-2 (2019-nCoV ...
-
Cas13d-mediated isoform-specific RNA knockdown with a unified computational and experimental toolboxbioRxiv - Genomics 2023Quote: ... and grown on Geltrex-coated plates (ThermoFisher Cat #A1413302). For passaging ...
-
bioRxiv - Cell Biology 2023Quote: ... It placed on a hot plate (Fisher Scientific; #HP88857204) at 120 °C for 1 h and was cool down to room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... The plates were sealed with adhesive film (ThermoFisher, Denmark) and incubated at 15°C for 48 h ...
-
bioRxiv - Neuroscience 2023Quote: ... The plates were then imaged using the CX7 (Thermofisher), channel 1-wide-field 386-23 ...
-
bioRxiv - Bioengineering 2024Quote: ... plates were blocked with 10% fetal bovine serum (Gibco) in sterile IMDM (Gibco ...
-
bioRxiv - Biochemistry 2024Quote: ... using a 96-well flat bottom plate (Fisher Scientific) by measuring absorbance at 350 nm at 37 °C at a regular interval of 2 min ...
-
Insulin Resistance Increases TNBC Aggressiveness and Brain Metastasis via Adipocyte-derived ExosomesbioRxiv - Cancer Biology 2024Quote: ... 8-m pore size transwell plates (Thermo Fisher Scientific). The cells were plated in the upper well of the transwell inserts with serum-free media ...
-
bioRxiv - Neuroscience 2024Quote: ... Plates (Nunc Immuno clear modules; Thermo Fisher Scientific 468667) were coated with anti-Flag antibody (Sigma-Aldrich F1804 ...
-
bioRxiv - Cancer Biology 2024Quote: ... plated in 96 well flat-bottom plates (Fisher Scientific) at a density of 500 cells/well ...
-
bioRxiv - Neuroscience 2024Quote: ... coated plates in DMEM-F12 media (Thermo Fisher, 11320033), supplemented with B27 (Thermo Fisher ...
-
bioRxiv - Microbiology 2024Quote: ... In a 96-well plate (Thermo Scientific #75800-396), 10 µL of each strain was inoculated to a 200 µL total volume of CM9 with or without supplemented 250 nM cobalt ...
-
bioRxiv - Cell Biology 2024Quote: A Streptavidin coated high-capacity plate (Thermo Fisher Scientific) was coated for 1 hr at room temperature with the CaptureSelect™ Biotin anti-AAV9 conjugate (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2024Quote: ... 96-well plates (Thermo Fisher or Greiner Bio-One). On day 1 ...
-
bioRxiv - Neuroscience 2024Quote: ... Nunc MaxiSorpTM flat-bottom 96-well-plates (Thermo Scientific) were coated with anti-mouse IL-6 capture antibody overnight at 4°C ...
-
bioRxiv - Immunology 2024Quote: ... Wells of Reacti-Bind plates (Thermo Scientific, cat. 15041) were coated at 4°C overnight with 2 μg/ml of ITS61.01 ...
-
bioRxiv - Cell Biology 2024Quote: ... was placed in white walled 96 well plates (Nunc MicroWell 96-Well ...
-
bioRxiv - Developmental Biology 2024Quote: ... Reactions were run in 384-well plates (Applied Biosystems) using the QuantStudio 5 Real-Time PCR system (Applied Biosystems ...
-
bioRxiv - Neuroscience 2024Quote: ... or Cellbind plates (6 or 96 well, Fisher Scientific) depending on the experiment.
-
bioRxiv - Microbiology 2024Quote: ... A 384-well plate (Thermo Fisher, cat. no. 12565294) containing each strain (Table S1 ...
-
bioRxiv - Cell Biology 2019Quote: Relative gene expression was determined using Taqman RNA-to-Ct 1-step kit (ThermoFisher) with TaqMan gene expression assays for CDKN1A (ThermoFisher) ...
-
bioRxiv - Immunology 2022Quote: ... amplified using the TaqMan Fast Virus 1-Step Master Mix qRT-PCR kit (Invitrogen) on a LightCycler 480 or LC96 instrument (Roche) ...
-
bioRxiv - Microbiology 2019Quote: ... Mitochondrial membrane potential was analyzed with a Mitoprobe™ JC-1 Assay kit (Invitrogen). Nuclear condensation was assessed by staining with the Hoechst® dye (Invitrogen) ...
-
bioRxiv - Genetics 2019Quote: pos-1 dsRNA was synthesized in vitro using a MEGAscript T7 Transcription Kit (Invitrogen). The transcription template was PCR-amplified from the Ahringer pos-1 RNAi clone and contained the pos-1 insert sequence as well as the flanking T7 promoters ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 µg of DNase I-treated RNA (Ambion DNA-free DNA removal kit (Invitrogen)) was used ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 µg of DNase I-treated RNA (Ambion DNA-free DNA removal kit (Invitrogen)) was used ...
-
bioRxiv - Cell Biology 2019Quote: ... TRA-1-60 with PSC 4-Marker Immunocytochemistry Kit (Life Technologies, A24881, lot 1610720) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 μg of genomic DNA extracted using the PureLink Genomic DNA Mini Kit (Invitrogen) was bisulfite-converted by using the Epimark Methylation kit (NEB) ...
-
bioRxiv - Pathology 2019Quote: ... DNA concentrations were concentration of 1-2nM using the SequalPrep™ Normalization Kit (Invitrogen). Samples were pooled into a single library which was analyzed using the TapeStation 4200 High Sensitivity D1000 assay (Agilent Technologies ...
-
bioRxiv - Immunology 2021Quote: ... or Power SYBR® Green RNA-to-CT™ 1-Step Kit (ThermoFisher Scientific) and LightCycler® 96 (Roche ...
-
bioRxiv - Pathology 2021Quote: ... beads were washed with LWB 1× buffer (Dynabeads® Co-Immunoprecipitation Kit (Life Technologies)) and incubated 5 min at RT under gentle rotation ...
-
bioRxiv - Cell Biology 2021Quote: ... Immunoprecipitation of Cav-1 was performed using Dynabeads™ Protein G Kit (ThermoFisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... using Power SYBR® Green RNA-to-CT™ 1-Step Kit (Thermo Fisher) as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and the Live/DeadTM Fixable Violet Dead Cell Stain Kit (1:1000; Invitrogen, L34955) in 100 μL of stain buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... was also used with the TaqMan RNA-to-CT 1-Step Kit (Applied Biosystems). For a complete list of primer names and sequences ...
-
bioRxiv - Microbiology 2020Quote: ... Thermal cycling conditions were adapted from Verso 1-step RT-qPCR kit (ThermoFisher, AB4101C) per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... using Power SYBR® Green RNA-to-CT™ 1-Step Kit (Thermo Fisher) as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... fix viability dye (LIVE/DEAD Fixable Aqua Dead Cell Stain Kit; 1:200; Invitrogen) and conjugated antibodies were added (see below ...
-
bioRxiv - Immunology 2019Quote: THP-1 cells were transfected with siRNAs using the Lipofectamine2000 Kit (Invitrogen, #11668-019) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... RNA (1 μg) was reverse transcribed using the Verso cDNA Synthesis Kit (ThermoFisher Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... We used the TaqMan® RNA-to-Ct™ 1-Step Kit (Applied Biosystems® by Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... and 0.5–1 μg was retrotranscribed using the TaqMan reverse transcription kit (Applied Biosystems). Real-time qPCR was performed using primers (MmDrosha Fw:5’ TGCAAGGCAATACGTGTCATAG 3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... Pre-miR-181a-1 in vitro synthesis was performed using T7 MEGAshortscriptTM kit (Ambion) from 1 µg purified DNA and following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... using Power SYBR® Green RNA-to-CT™ 1-Step Kit (Thermo Fisher) as per the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... 10 µg of RNA was treated with 1 µl of DNAse (Invitrogen TURBO kit) at 37 °C for 30 min ...