Labshake search
Citations for Thermo Fisher :
3451 - 3500 of 10000+ citations for 6 AMINO 4 METHYL INDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... 100X nonessential amino acids (11140-050) and 100X penicillin streptomycin (15140-122) were from Gibco. Protease inhibitor cocktail complete EDTA-free was from Roche ...
-
bioRxiv - Biochemistry 2020Quote: ... ß-tubulin (amino acids 388–444) was cloned into the pProEx HTa expression vector (Life Technologies). All oligonucleotides used are listed in Supplementary Table 1.
-
bioRxiv - Cell Biology 2021Quote: ... 100 U/ml penicillin/streptomycin and 1X non-essential amino acids (ThermoFisher Scientific, Waltham, MA). The CRISPR/Cas9 gene-edited NIH3T3 cell line expressing endogenous levels of EHD1 with GFP attached to its C-terminus was generated as described previously (Yeow et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 10% fetal bovine serum (Hyclone, not heat inactivated) and non-essential amino acids (Gibco). Cells were plated one day prior such that transfection was conducted at a confluency of 70-90% ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.1 mM non-essential amino acids (NEAA)(11140-076, Gibco; Thermo Fisher Scientific, MA, USA), 1% penicillin-streptomycin (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.1 mM non-essential amino acids (NEAA)(11140-076, Gibco; Thermo Fisher Scientific, MA, USA), 1% penicillin-streptomycin (Invitrogen) ...
-
bioRxiv - Bioengineering 2019Quote: ... were fluorescently labelled with an amino reactive dye (DyLight® NHS Ester, Thermo Fisher Scientific) following the manufacturer’s instructions ...
-
Pseudohypoxic HIF pathway activation dysregulates collagen structure-function in human lung fibrosisbioRxiv - Cell Biology 2021Quote: ... 1mM sodium pyruvate and 1x non-essential amino acids (DMEM/FBS) (Life Technologies, Paisley, UK). All cells were kept at 37 °C and 5% CO2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1% v/v non-essential amino acids (NEAA) and 1% v/v penicillin-streptomycin (Invitrogen). Corresponding cell line origins ...
-
bioRxiv - Bioengineering 2022Quote: ... 100 U/mL of streptomycin) (HyClone),1% (v/v) MEM non-essential amino acid (Gibco). Human monocytic U937 cells (ATCC ...
-
bioRxiv - Microbiology 2022Quote: ... non-essential amino-acids and 1mM sodium pyruvate and 10% of foetal bovine serum (Thermofisher). The used luciferase substrate for the detection of luminescence was The NanoGlo live assay ...
-
bioRxiv - Immunology 2020Quote: ... 1% minimum essential medium nonessential amino acids (100x MEM NEAA; Gibco Cat No 11140-035) and 1 mM sodium pyruvate (100 mM ...
-
bioRxiv - Immunology 2020Quote: ... 1% 100X non-essential amino acids) plus 1μg/ml puromycin and 10μg/ml blasticidin (Invitrogen)) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1x non-essential amino acid solution (Cytiva, SH3023801) and 10 mM sodium pyruvate (Gibco, # 11360070). All cell lines were incubated at 37°C in the presence of 5% CO2.
-
bioRxiv - Microbiology 2020Quote: ... 50 U.mL−1 penicillin/streptomycin and non-essential amino acids (all reagents from Invitrogen, UK). All cells were maintained in a 5 % CO2 atmosphere at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 100 μg per ml streptomycin and 100 μM MEM Non Essential Amino Acids Solution (Gibco). Cell culture reagents were purchased from Hyclone ...
-
bioRxiv - Molecular Biology 2021Quote: ... the amino acids were applied to a liquid chromatograph system (Thermo Fisher Scientific, Vanquish UHPLC). The amino acids loaded on a C18 column (YMC ...
-
bioRxiv - Molecular Biology 2023Quote: ... All cells were supplemented with 0.1 mM MEM non-essential amino acids (Gibco/Thermo Fisher), 2 mM L-glutamine ...
-
bioRxiv - Molecular Biology 2023Quote: ... All cells were supplemented with 0.1 mM MEM non-essential amino acids (Gibco/Thermo Fisher), 2 mM L-glutamine ...
-
bioRxiv - Immunology 2024Quote: ... supplemented with 1% MEM Non-essential amino acids solution (11140-050, ThermoFisher, Waltham, MA, USA) and 10% FBS (SH30396.03 ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1% (v/v) non-essential amino acids (catalog number 11140050, Gibco / Thermo Fisher Scientific). Differentiation into a co-culture of non-dividing cells that exhibit neuronal and astrocytic characteristics was initiated with the removal of growth factors and heparin salt from media ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1% (v/v) non-essential amino acids (catalog number 11140050, Gibco / Thermo Fisher Scientific). Differentiation into a co-culture of non-dividing cells that exhibit neuronal and astrocytic characteristics was initiated with the removal of growth factors and heparin salt from media ...
-
bioRxiv - Synthetic Biology 2022Quote: ... were cultured in DMEM with 10% FBS and supplemented with nonessential amino acids (Life Technologies) and Glutamax (Life Technologies).
-
Tuning non-linear mechanics in collagen hydrogels modulates cellular morphotypes in three dimensionsbioRxiv - Biophysics 2024Quote: ... and 5 mL Minimum Essential Medium Non-Essential Amino Acids (MEM NEAA, 100 X, Gibco). 1205 Lu endogenously labelled for meGFP-α-Tubulin (CRISP ...
-
bioRxiv - Immunology 2024Quote: ... Caco2 cells culture medium was supplemented with 1% MEM Non-Essential Amino Acids (Gibco 11140035). All viral inoculations and infections were made in DMEM containing 2% FCS (D2).
-
bioRxiv - Cancer Biology 2024Quote: ... 1% MEM non-essential amino acids solution and 1% MEM vitamin solution (all Thermo Fisher). PDAC cell line MIA PaCa-2 was cultured in DMEM supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Cancer Biology 2022Quote: ... NMR culture media was further supplemented with 1X non-essential amino acids (#11140-050; Gibco) and 1 mM sodium pyruvate (#11360-039 ...
-
bioRxiv - Cancer Biology 2022Quote: ... NMR culture media was further supplemented with 1X non-essential amino acids (#11140-050; Gibco) and 1 mM sodium pyruvate (#11360-039 ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.1 mM non-essential amino acids (NEAA) (11140-076, Gibco; Thermo Fisher Scientific, MA, USA), 1% penicillin-streptomycin (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and 1X MEM Non-Essential Amino Acids Solution (11140050, Gibco, Grand Island, New York, USA) at 5% CO2 and 37oC ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1% minimum essential medium (MEM) Non-Essential Amino Acids 100x (NEAA, Gibco, #11140-035). For MDA-MB-231 with stable shRNA-mediated MCT4 KD (described in (Andersen et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 mM L-glutamine (Cytiva SH30024) supplemented with 1% nonessential amino acids (Gibco 11140-050) and 10% FBS (Corning 35-011-CV ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.1 mM non-essential amino acids (NEAA) (11140-076, Gibco; Thermo Fisher Scientific, MA, USA), 1% penicillin-streptomycin (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... and DMEM/F12 medium supplemented with1× MEM nonessential amino acids (NEAA) (ThermoFisher, cat. no. 11140050), 2 μg/ml doxycycline (Clontech ...
-
bioRxiv - Biophysics 2023Quote: ... 1× PS and 1× MEM non-essential amino acids (NEAAs; catalog no. 11140-050, Gibco). Cells were cultured in a humidified atmosphere with 5% CO2 at 37 °C and passaged every 2 or 3 d ...
-
bioRxiv - Immunology 2024Quote: ... These labels were supplemented in amino acid-free carbohydrate free FreeStyle293™ medium (Life Technologies) along with 1g/L glutamine,100 mg/L of the other amino acids and 3 g/L glucose ...
-
bioRxiv - Bioengineering 2024Quote: Cy7.5-dextran was prepared through coupling of 500 kDa MW amino dextran (Thermo Fisher Scientific) with Cy7.5 NHS ester (Lumiprobe ...
-
bioRxiv - Neuroscience 2024Quote: ... supplemented with 1 x MEM Non-Essential Amino Acids Solution (Gibco; Cat. No. 11140-050), 1 x N2 supplement (Gibco ...
-
bioRxiv - Immunology 2024Quote: For total amino acid starvation cells were cultured in Hanks’ Balanced Salt solution (HBSS, Gibco).
-
bioRxiv - Bioengineering 2024Quote: ... Caco-2 cell medium was also supplemented with 1% nonessential amino acids (Thermo Fisher Scientific). Cells were seeded with a density of 300.000 cells/mL DMEM ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Nvsix3/6:venus was generated by subcloning the Nvsix3/6 coding sequence into pENTR/D TOPO (ThermoFisher Scientific) using published primers previously used to PCR amplify Nvsix3/6 and synthesize Nvsix3/6 mRNA 47 ...
-
bioRxiv - Microbiology 2021Quote: ... thaliana seedlings cultured in 6 ml liquid MSgg of each well of a 6-well microplate (Thermo Scientific). 8 seedlings were put in each well ...
-
bioRxiv - Microbiology 2020Quote: ... Cells in antibiotic free media (8×105/6-well) were transfected 6 hours post infection with 2μg plasmid and 6μl Lipofectamine 2000 (Invitrogen) per well diluted in Opti-MEM (Invitrogen).
-
bioRxiv - Physiology 2023Quote: ... IL-6 and FFA content were measured by ELISA (IL-1β, Biolegend, 432604; IL-6, Invitrogen, BMS603-2) or a FFA fluorometric kit (Cayman Chemical ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Jurkat cells and NALM-6 expressing firefly luciferase- GFP (NALM-6) were cultured in RPMI 1640 (Thermo Fisher) supplemented with 10% FBS and 100 units/mL penicillin and streptomycin ...
-
bioRxiv - Developmental Biology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific). Cells were imaged using a Zeiss Axio fluorescence microscope.
-
bioRxiv - Neuroscience 2021Quote: ... with Essential 6 medium (#A1516401; Life Technologies) containing dorsomorphin (2.5 μM ...
-
bioRxiv - Molecular Biology 2020Quote: ... Twelve-well Novex 6% Trisglycine gels (Invitrogen) were pre-run in 0.5× Tris-Borate-EDTA (TBE ...
-
bioRxiv - Neuroscience 2021Quote: ... 6 diamidino-2-phenylindole dihydrochloride (DAPI; Invitrogen) for 3 min and washed ...