Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for Recombinant Human Interleukin 6 Receptor His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: Recombinant Rep1ΔAD-His and its variants were incubated with 50 μl D–Galactose agarose beads (Thermo Scientific) overnight at 4 °C ...
-
bioRxiv - Microbiology 2019Quote: ... 6×His-Lsr2 was purified by binding to 1 mL Ni-NTA agarose (Invitrogen), after which the resin was collected and the bound protein was washed with binding buffer supplemented with increasing concentrations of imidazole ...
-
bioRxiv - Biochemistry 2023Quote: ... 1.0 mg/mL recombinant human insulin, 0.55 mg/mL human transferrin, 0.67 μg/mL sodium selenite, Gibco), and 0.04 μg/mL dexamethasone (Sigma Aldrich) ...
-
bioRxiv - Immunology 2023Quote: ... 1% PenStrep and 100IU/ml interleukin-2 (ThermoFisher). K562 cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... Plasma IL-6 was measured by immunoassay (ProQuantum Human IL-6 Immunoassay Kit, ThermoFisher) and run on the ABI 7300 (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2020Quote: 6xHis-tagged REV-ERBβ LBD (4 nM) was incubated with anti-His antibody conjugated to terbium (1 nM) (ThermoFisher #PV5863) and FITC-labeled NCoR ID1 or NCoR ID2 peptide (400 nM ...
-
bioRxiv - Bioengineering 2022Quote: ... supernatants were harvested and filtered with a 0.22 µm membrane.The His-tagged proteins were purified with the HisPur Ni- NTA Resin (Thermo Fisher, 88222). After three columns of washing with 25 mM Imidazole (pH 7.4) ...
-
bioRxiv - Cell Biology 2019Quote: ... 1-2 μg His-tagged calcineurin was first bound to Ni-NTA-agarose or magnetic Dynabeads (Thermo Fisher Sci. USA) in base buffer (50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Biochemistry 2019Quote: ... mCherry-(backbone pLV-CMV-bc) and FLAG-His-tagged(backbone Pcdna3) p16INK4A constructs were created using gateway technology (Life Technologies). For cell cycle profiling ...
-
bioRxiv - Bioengineering 2021Quote: ... supernatants were harvested and filtered with a 0.22 μm membrane.The His-tagged proteins were purified with the HisPur Ni-NTA Resin (Thermo Fisher, 88222). After three columns of washing with 25 mM Imidazole (pH 7.4) ...
-
bioRxiv - Cell Biology 2022Quote: His- and GST-tagged CFAP418 proteins were expressed in One Shot™ BL21 Star™ (DE3) cells (ThermoFisher, Waltham, MA) and purified using HisPur™ Ni-NTA resin and Pierce™ Glutathione Superflow Agarose ...
-
bioRxiv - Cell Biology 2019Quote: ... Infected Sf9 cells were grown in spinner culture for 48–96 h at 27°C and His-tagged protein-purified using Ni2+-NTA agarose (Invitrogen) according to standard procedures ...
-
bioRxiv - Molecular Biology 2020Quote: Plasmid encoding the N-terminally His-tagged Msm HelD protein was prepared by the GeneArt® Plasmid Construction Service (Thermofisher). Gene construct for HelD expression was designed by codon-optimized back translation of gene MSMEG_2174 from Msm (strain ATCC 700084 / mc2 155 ...
-
bioRxiv - Microbiology 2020Quote: ... The His-tagged protein was purified from the cleared cell lysate by nickel affinity chromatography (Ni-NTA agarose beads, Invitrogen). After washing with increasing concentrations of imidazole ...
-
bioRxiv - Immunology 2020Quote: Human mannose receptor (CD206) siRNA (UACUGUCGCAGGUAUCAUCCA) or a non-targeting siRNA sequence control (4390843, Life Technologies) were transfected into HMDM (RNAiMax ...
-
bioRxiv - Biochemistry 2023Quote: ... 6 µg RNA was used and RNaseOUT recombinant ribonuclease inhibitor (1 µl) (Invitrogen) was added ...
-
bioRxiv - Neuroscience 2019Quote: ... and 20 ng/mL recombinant human fibroblast growth factor-basic (Life Technologies). After 3 to 6 weeks ...
-
bioRxiv - Microbiology 2021Quote: ... 20 ng/ml of recombinant human epidermal growth factor (EGF, Life Technologies), human insulin (Sigma) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 10 ng/ml bFGF recombinant human protein (Thermo Fisher Scientific, USA). From day 6 until day 12 the medium was changed once in two days with the addition of 1 mM valproic acid (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... Human recombinant epidermal growth factor (hEGF) protein was purchased from Life Technologies and dissolved in PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... 10 ng/ml recombinant human basic fibroblast growth factor (Invitrogen, Waltham, MA) (hiPSC medium).
-
bioRxiv - Physiology 2020Quote: ... and 2.5 ng/ml recombinant human hepatocyte growth factor (Gibco, Loughborough, UK). Skeletal muscle myoblasts were incubated at 37°C in a humidified atmosphere of 5% CO2 until 80% confluence ...
-
bioRxiv - Cell Biology 2020Quote: ... The recombinant human EGF used in this study was from Thermo Fisher Scientific and the recombinant human HGF was generously provided by Drs ...
-
bioRxiv - Microbiology 2021Quote: ... Human alpha-1 PDX (alpha1-PDX) recombinant protein was purchased from ThermoFisher Scientific.
-
bioRxiv - Microbiology 2021Quote: ... 5 μg of FGFb Recombinant Human Protein and 1% Gluta-MaxTM (Gibco) in flasks coated with Matrigel Matrix Basement Membrane (Corning ...
-
bioRxiv - Developmental Biology 2022Quote: ... 10 ng/mL Human TGF-β 1 recombinant protein (Cat# PHG9204, Gibco) and 1 μg/mL L-Ascorbic acid 2-phosphate (Cat# A8960 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... on plates coated with recombinant human collagen I (Coating Matrix kit, Gibco) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 ng/mL human recombinant GM-CSF (Thermo Fisher Scientific, USA) at 37 °C and 5 % carbon dioxide ...
-
bioRxiv - Cancer Biology 2023Quote: ... human recombinant EGF (10 ng/ml) (Thermo Fisher Scientific, Waltham, MA, USA), D-glucose (5.5 mM ...
-
bioRxiv - Cell Biology 2023Quote: ... Human recombinant plasminogen activator inhibitor 1 (PAI-1) was from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 ng/mL human recombinant GM-CSF (Thermo Fisher Scientific, USA). The incubator condition was set at 37 °C with 5 % carbon dioxide environment ...
-
bioRxiv - Cell Biology 2023Quote: ... human recombinant fibroblast growth factor 2 (FGF2, 20 ng/mL, Life Technologies), and beta-mercaptoethanol (0.1% ...
-
bioRxiv - Cancer Biology 2023Quote: ... bovine pituitary extract and human recombinant epidermal growth factor (Gibco, 37000-015)) and primary gingival keratinocyte (Dermal cell basal medium (ATCC ...
-
bioRxiv - Cell Biology 2023Quote: ... hiPSCs were cultured on human recombinant vitronectin in StemFlexTM media (Life Technologies) and differentiation was initiated by plating singularised hiPSCs on human embryonic stem cells (hESC)-qualified Matrigel (Corning ...
-
bioRxiv - Immunology 2023Quote: ... Recombinant human IFN-β (1000 U/ml to 1 U/ml, ThermoFisher) was used as positive controls for IRF activation ...
-
bioRxiv - Cell Biology 2024Quote: ... 20 % FBS and 200 ng/mL Human M-CSF Recombinant Protein (ThermoFisher). Six days after the initial isolation ...
-
bioRxiv - Biochemistry 2022Quote: ... recombinant human RPA or RPA-variants (2 μM) were incubated with 250 nM of recombinant Aurora B kinase (Invitrogen Inc.) in kinase reaction buffer (50 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2023Quote: ... Human IL-6 ELISA kit was from Life Technologies. FAN1KO HD patient fibroblasts were generated and received from Synthego ...
-
bioRxiv - Cell Biology 2024Quote: ... human IL-6 Uncoated ELISA (88-7066-88, Invitrogen) and human GRO alpha (CXCL1 ...
-
bioRxiv - Genetics 2023Quote: ... androgen receptor (Invitrogen), PTK2 (Invitrogen) ...
-
bioRxiv - Immunology 2023Quote: The DNA coding sequences of tagged recombinant GITRL and OX40L were produced by GeneArt Gene Synthesis service (ThermoFisher Scientific). The sequences of GITRL and OX40L constructs contain ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Im7-6 was purified from IVG reactions using magnetic His-tag Dynabeads (Thermo Fisher Scientific). The IVG reactions were diluted in 90 µl of Buffer 1 (50 mM NaH2PO4 and 300 mM NaCl ...
-
bioRxiv - Biochemistry 2022Quote: ... each with an N-terminal (His)6 tag from plasmids generated by GeneArt (ThermoFisher Scientific). For each purification ...
-
bioRxiv - Biochemistry 2022Quote: ... His6- tagged SPOC domains were purified by affinity chromatography using HisTrap HP column (Cytiva) or His-Pur Ni-NTA resin (Thermo Scientific) equilibrated in 25 mM Tris-Cl pH 7.4 ...
-
bioRxiv - Biochemistry 2021Quote: ... the N-terminal His-tagged protein was purified in a single step protocol using HisPur Ni-NTA resin (Thermo Fisher Scientific), equilibrated at RT ...
-
bioRxiv - Cancer Biology 2023Quote: ... The 6X His tagged extracellular domain of hPD-L1 WT or 2HA proteins were expressed in the ExpiCHO cell system (ThermoFisher Scientific) and purified by the Ni-NTA agarose (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... mammalian expression constructs carrying C-terminal 6X-His tagged gene of interest (HpARI1-3, or ST2 ectodomain) were transfected individually into Expi293F cells (Thermo Fisher) using the Expifectamine transfection kit (Thermo Fisher) ...
-
bioRxiv - Microbiology 2020Quote: ... hACE2 receptor (hACE2 Recombinant Rabbit Monoclonal Antibody, 1:50, Thermo-Fisher, Cat#SN0754) and DAPI nuclear stain (1:20,000, Invitrogen, Carlsbad, CA). The primary antibodies were detected with goat anti-rabbit-AP developed with Permanent Red warp (mach3 Biocare Medical).
-
bioRxiv - Bioengineering 2020Quote: ... and 20 ng/ml interleukin 13 (IL-13; Gibco).
-
bioRxiv - Immunology 2024Quote: ... corresponding to the concentration of the highest standard of recombinant human IFNγ (Human IFNγ Gamma Uncoated ELISA kit, Invitrogen). IFNγ concentrations below the level of detection by the ELISA standard curve were set to 0 pg/ml ...