Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for PCR Plates since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... The well-plate was subsequently incubated at 30 °C for 50 minutes in the thermocycler QuantStudio 5 real-time PCR system (Applied Biosystems). SYBR® Green I fluorescence was recorded each minute throughout the incubation ...
-
bioRxiv - Immunology 2024Quote: ... 10ng cDNA was used for quantitative PCR in technical triplicates in a 384 well plate using SYBR Green Supermix (Applied Biosystems). PCR was run in Applied Biosystems QuantStudio™ 12K Flex Real-Time PCR at the Advanced Genomics Core at the University of Michigan ...
-
bioRxiv - Immunology 2022Quote: ... ELISA plates (96-well plates, Immunol4HBX, Thermo Fisher) were coated with a 50/50 mixture of His-Spy-RBD and RBD-Spy-His (2 μg/mL ...
-
bioRxiv - Microbiology 2019Quote: ... SAB agar plates (5-cm plates, Fisher Scientific) inoculated with 200 μL of a M ...
-
bioRxiv - Bioengineering 2020Quote: 96-well plates (Nunc MediSorp plates; Thermo Scientific) were coated overnight at 4 °C with 50 ng/well of purified antigen (recombinant RSVF or designed immunogens ...
-
bioRxiv - Bioengineering 2020Quote: 96-well plates (Nunc MediSorp plates; Thermo Scientific) were coated overnight at 4 °C with 50 ng/well of purified antigen (recombinant RSVF or designed immunogens ...
-
bioRxiv - Immunology 2020Quote: ... Maxisorb 96-well plates (Nunc-immuno plates, Dutscher) were coated overnight at room temperature (RT ...
-
bioRxiv - Immunology 2022Quote: ... Nunc Immuno Plate MaxiSorp plates (Thermo Fisher Scientific) were coated either with 50 μg/ml NP4-BSA or 50 μg/ml NP26-BSA and incubated overnight at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Plates (Nunc Immuno clear modules ...
-
bioRxiv - Microbiology 2023Quote: ... Plates (Nunc maxisorp ...
-
bioRxiv - Microbiology 2019Quote: ... immunoassay plates (96-well plates; Nunc, Rochester, NY, USA) were coated with 100 ng/well of purified antigens at 4°C overnight ...
-
bioRxiv - Developmental Biology 2021Quote: ... The plate was applied to a plate magnet (Invitrogen) until the solution cleared and the supernatant was removed without disturbing the beads ...
-
bioRxiv - Biochemistry 2019Quote: ... The ELISA plates (Nunc-Immuno Plate; Thermo Scientific, Denmark) were primarily coated with 1 μg TLR2 protein in 100 μl PBS buffer and incubated for 2 h at 37°C ...
-
bioRxiv - Neuroscience 2019Quote: ... tissue culture plates (4-well plates; Nunc, Wiesbaden, Germany) were coated with poly-D-lysine (PDL ...
-
bioRxiv - Physiology 2019Quote: ... The plate was applied to a plate magnet (Invitrogen) until the solution cleared and the supernatant was removed without disturbing the beads ...
-
bioRxiv - Immunology 2022Quote: ... Immunlon 2HB plates 96-well plates (Thermo Scientific 3455) were coated with 50µl of Wuhan-Hu-1 RBD protein (gift of Institute for Protein Design ...
-
bioRxiv - Microbiology 2022Quote: ... 96-well microtiter plates (Immulon 2HB plates, Thermo Scientific) were coated with sequentially diluted spRSV/A/Bernett or spRSV/B/BA in PBS (starting at 10 µg/mL or 15 µg/mL of total protein ...
-
bioRxiv - Microbiology 2022Quote: ... The plate was applied to a plate magnet (Invitrogen) until the solution cleared and the supernatant was removed without disturbing the beads ...
-
bioRxiv - Biochemistry 2022Quote: ... in 96-well white plates (Armadillo plate, Thermo Scientific) using an integration time of 120ms ...
-
bioRxiv - Microbiology 2019Quote: ... using a Micro Amp Fast Optical 48-well reaction plate with 15 μ L reaction volume containing 1 x Power Sybr Green PCR Master Mix (Thermo Fisher), 0.2 μM of each primer and 1.5 μg of cDNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... AATGATACGGCGACCACCGAGATCTACACXXXXXXXXTCGTCGGCAGCGTC Reverse indexing primer: CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTCTCGTGGGCTCGG The indexing PCR reactions were then purified and normalized using a SequalPrep normalization plate (Thermo Fisher Scientific), followed by elution in 20 µl of elution buffer ...
-
bioRxiv - Microbiology 2019Quote: ... Each sample was quantified by targeting tp0574 through qPCR using a 96-well reaction plate with a ViiA 7 Real-Time PCR System (Applied Biosystems, USA) according to the protocals already established in the laboratory [31] ...
-
bioRxiv - Cancer Biology 2019Quote: ... Reactions were diluted 4-fold with H2O and qPCR was performed in 10 μL reaction volume in 96-well plates using PowerUp SYBR Green PCR Master mix (Thermo Fisher Scientific), 2 μL diluted cDNA preparation ...
-
bioRxiv - Developmental Biology 2020Quote: ... Samples were loaded onto 384-well plates in triplicate and run on a ViiA 7 Real-Time PCR system (Thermo Fisher Scientific) where gene expression was normalized to β-actin and determined using the ΔΔCt formula.
-
bioRxiv - Physiology 2022Quote: ... EcoDry RNA to cDNA reaction tubes and a SimpliAmp Thermal Cylinder were then used to facilitate the generation of cDNA which was then analyzed using a 96-well qPCR reaction plate and the StepOnePlus Real-Time PCR System (Applied Biosystems, #272004476). Assays were performed with KAPA SYBR FAST (Roche ...
-
bioRxiv - Biophysics 2022Quote: ... Transformants were selected on 60 µg/mL Gm-infused LB Lennox agar plates and the insert size was verified by PCR with Pk18-F and Pk18-R primers using Taq Polymerase (Thermo Fisher, USA). A triparental mating was performed with PA14 flgK::Tn5 to generate PA14 flgK::Tn5 ΔrhlA gene deletion ...
-
bioRxiv - Plant Biology 2021Quote: ... Reactions were placed in 96-well plates and read with the Fast 7500/7500 Real-Time PCR System (Applied Biosystems, Waltham, USA). Ct determination was performed using the Fast 7500/7500 Real-Time PCR System built-in software (Applied Biosystems ...
-
bioRxiv - Biochemistry 2021Quote: ... The qPCR reactions were performed in 96-well plates using a ViiA™ 7 Real-Time PCR System (Applied Biosystems, ThermoFisher Scientific) in 20 μL reaction volumes ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Quantitative polymerase chain reactions (qPCRs) were performed in 384-well plates in a 7900HT fast real-time PCR (Thermo Fisher, Madrid, Spain) using iTaq Universal SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Physiology 2022Quote: ... The cDNA-equivalent of 5 ng RNA was used for amplification in 384-well microtitre plates in a QuantStudio 5 Real-Time PCR System (Applied Biosystems, USA) in a final reaction volume of 10 μl containing 5μL PowerUP SYBR Green master mix (Applied BiosySDs ...
-
bioRxiv - Microbiology 2019Quote: ... The RT-PCR mixture (total volume 12 µl) was transferred to 96-well Reaction Plates (0.1 mL) (Applied Biosystems, Foster City, CA) and then RT-PCR amplification was conducted on a 7500 Fast Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... following the manufacturer’s protocol and RT-qPCR performed in 384-well plates using a QuantStudio™ 5 Real-Time PCR System (Applied Biosystems™). Primer/probe pairs were ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The reactions were prepared in PCR tubes on ice and 15 µL of each was pipetted into 384-well plates (Thermo Scientific 242764). GFP fluorescence out of each circuit was recorded in the plate reader at 30℃ (gain ...
-
bioRxiv - Genetics 2021Quote: ... Cox-2 and the 18S rRNA control was assessed through real-time PCR using TaqMan® Gene Expression Array Plates (ThermoFisher Scientific) containing predesigned ...
-
bioRxiv - Biochemistry 2021Quote: ... The qPCR reactions were performed in 96-well plates using a ViiA™ 7 Real-Time PCR System (Applied Biosystems, ThermoFisher Scientific) in 20 μL reaction volumes ...
-
bioRxiv - Immunology 2021Quote: ... following the manufacturer’s protocol and performed in 384-well plates using a QuantStudio™ 5 Real-Time PCR System (Applied Biosystems™). Primer/probe pairs were ...
-
bioRxiv - Plant Biology 2023Quote: ... Relative enrichment levels were determined by ChIP-qPCR in an optical 384-well plate in the QuantStudio™ 6 Flex Real-Time PCR System (ThermoFisher Scientific), using FastStart Universal SYBR Green Master (Rox ...
-
bioRxiv - Cancer Biology 2023Quote: ... qPCR reactions were performed using primers designed on primer BLAST (Table 5).99 Reactions were performed in triplicate (both biological and technical) in a 384-well plate using the ViiA 7 Real-Time PCR System (Thermo Fisher Scientific) or the 7900HT Fast Real-Time PCR System (Thermo Fisher Scientific).
-
bioRxiv - Plant Biology 2024Quote: RT-qPCR was carried out in 96-well plates with three technical replicates per sample using a StepOnePlusTM Real-Time PCR System (Applied Biosystems, USA). RT-qPCR design ...
-
bioRxiv - Cancer Biology 2021Quote: ... for PCR (PCR SuperMix High Fidelity, Thermofisher). PCR products were gel extracted and then Sanger sequenced using both 5’- and 3’-end primers to confirm reads from each end of the product ...
-
bioRxiv - Neuroscience 2020Quote: ... ELISA plates (Nunc, MaxiSorp, 96 well plates, 44-2404-21) were coated with 100ul human C3b at 3 μg/mL in PBS (covered ...
-
bioRxiv - Cell Biology 2022Quote: ... 96 well microtiter plate Maxi-Sorp micro-titter plates (Nunc International ...
-
bioRxiv - Neuroscience 2020Quote: ... The plate was then applied to a plate magnet (Invitrogen) until the solution cleared and the supernatant was removed without disturbing the beads ...
-
bioRxiv - Microbiology 2021Quote: ... ELISA plates (96-well plates, Immunol 4HBX, Thermo Fisher Scientific) were coated with either spike receptor binding domain (S-RBD ...
-
bioRxiv - Microbiology 2020Quote: ... ELISA plates (F96 maxisorp Nunc-immuno plates, Nunc, Roskilde, Denmark) were coated with 140 μL of a suspension containing formalin-inactivated Salmonella Typhimurium varietas Copenhagen strain DAB69 bacteria diluted in coating buffer to an optical density (OD ...
-
bioRxiv - Microbiology 2020Quote: ... ELISA plates (F96 maxisorp Nunc-immuno plates, Nunc, Roskilde, Denmark) were coated with 140 μL of a suspension containing formalin-inactivated Salmonella Typhimurium varietas Copenhagen strain DAB69 bacteria diluted in coating buffer to an optical density (OD ...
-
bioRxiv - Immunology 2022Quote: ... flat-bottomed 96-well plates (Nunc Cell-Culture Plates, ThermoFisher) were coated with 1 µg/ml anti-CD3 and 2 µg/ml anti-CD28 antibodies (BioLegend ...
-
bioRxiv - Immunology 2022Quote: ... flat-bottomed 96-well plates (Nunc Cell-Culture Plates, ThermoFisher) were coated with 1 µg/ml anti-CD3 and 2 µg/ml anti-CD28 antibodies (BioLegend ...
-
bioRxiv - Pathology 2023Quote: ... The plate was sealed (plate sealer film, Nalgene Nunc International), incubated at 50°C in a BMG FLUOstar Omega plate reader and subjected to cycles of 1 min shaking (700 rpm double orbital ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Plates were covered with an adhesive plate seal (Thermo Scientific), before putting it in the plate reader ...