Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for N6 2 aminoethyl 9H purine 2 6 diamine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... 6-diamidino-2-phenylindole (DAPI, 50 μg/ml, D1306; Thermo Fisher Sci) was added to visualize the cell nuclei ...
-
bioRxiv - Microbiology 2024Quote: ... Nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole, Molecular Probes) and fluorescence microscopy images were captured using a Nikon Eclipse 80i Fluorescence microscope equipped with a DS-Qi1Mc camera with a 100X magnification.
-
bioRxiv - Neuroscience 2024Quote: 6-8 dpf larvae were embedded in 2% low melt agarose (Invitrogen) on 100 mm square (Thermo Scientific (cat# 109-17) ...
-
bioRxiv - Neuroscience 2024Quote: ... 6-diamidino-2-phenylindole (DAPI, 50 μg/ml, D1306; Thermo Fisher Sci) was added to visualize the cell nuclei ...
-
bioRxiv - Neuroscience 2024Quote: ... incubated with DAPI (4′,6- diamidino-2-phenylindole, Invitrogen, catalogue number D1306) (0.5µg/ml in PBS ...
-
bioRxiv - Developmental Biology 2024Quote: ... Sections were counterstained with 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, D1306) and coverslipped in Aqua-Poly/Mount (Polysciences #18606).
-
bioRxiv - Immunology 2024Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) or Live/dead fixable blue (ThermoFisher) was used to exclude dead cells.
-
bioRxiv - Microbiology 2024Quote: ... stained with 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Invitrogen, 100ng/ul) and imaged immediately.
-
bioRxiv - Immunology 2024Quote: ... the nuclei were counterstained with DAPI (4’,6-diamidino-2-phenylindole, ThermoFisher, Cat # D1306 ...
-
bioRxiv - Biophysics 2024Quote: ... The fluorescent dye 6-dodecanoyl-2-dimethylaminonaphthalene (LAURDAN) was purchased from Thermofisher Scientific (USA) ...
-
bioRxiv - Biophysics 2024Quote: ... the nucleus with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen, 1:200), microtubules with an anti-tubulin antibody produced in mouse (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2024Quote: ... The nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen). Fluorescent images were captured at seven fields of view using an inverted fluorescent microscope (Optics11 Life ...
-
bioRxiv - Cell Biology 2024Quote: ... 10µM of laurdan probe (6-Dodecanoyl-2-Dimethylaminonaphthalene) (Thermofisher, Cat no. D250) was added to the cells in RPMI 1640 (1x ...
-
bioRxiv - Cancer Biology 2024Quote: ... added with DAPI (4′,6-diamidino-2-phenylindole, Life Technologies, Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... 6-diamidino-2 phenylindol (DAPI, 1 ug/mL; Thermo Fisher, Waltham, MA), and AlexaFluor 488 phalloidin (1:100 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Culture medium was refreshed every 2–3 days and organoids were passaged 1:2–1:6 every 7–21 days using TrypLE Express (Thermo Fisher). For co-culturing ...
-
bioRxiv - Molecular Biology 2021Quote: Approximately 60 WT and MafAS64F/+ islets from at least 6 female and male mice were analyzed with the ratiometric calcium indicator fura-2-acetoxymethylester (Fura-2 AM) (Life Technologies). Islets were maintained in 5 mM glucose for 30 min prior to measuring 11 mM glucose-induced calcium oscillations and depolarization-activated calcium influx with 30 mM KCl ...
-
bioRxiv - Neuroscience 2021Quote: ... and immersed in reagent-2 (diluted 1:2 in PBS) for 6-24 h before incubated in reagent-2 containing TO-PRO-3 (1:5,000, Thermo Fisher Scientific) for additional 7-10 days ...
-
bioRxiv - Bioengineering 2024Quote: Coronal sections of healthy murine brain were prepared and stained as previously described101 either using 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng mL−1; Molecular Probes) to stain cell nuclei or primary antibodies for rabbit anti-NeuN (1:1000) ...
-
bioRxiv - Physiology 2023Quote: ... IL-6 and FFA content were measured by ELISA (IL-1β, Biolegend, 432604; IL-6, Invitrogen, BMS603-2) or a FFA fluorometric kit (Cayman Chemical ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Molecular Biology 2021Quote: ... Nuclei were detected by 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, Carlsbad, CA).
-
bioRxiv - Molecular Biology 2020Quote: ... and nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific) at 1:2,000 dilution at RT for 5 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... All samples were counterstained in 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen, D1306) for 10 minutes at room-temperature and mounted in ProLong Gold Antifade (Thermo fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... Cell nuclei were labelled using 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI, Invitrogen) and coverslipped using ProLong Gold anti-fade reagent (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... Nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (1:10,000, Invitrogen) for 3 min and eventually coverslips were mounted with Dako mounting kit (Fluka) ...
-
bioRxiv - Microbiology 2020Quote: ... Nuclei were stained with DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (Life Technologies) at a dilution of 1:5000 in 1 X PBS ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were counterstained using 4’ ,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) to visualize the nuclei ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were counterstained using 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) to visualize the nuclei and finally washed with PBS.
-
bioRxiv - Cancer Biology 2021Quote: ... The nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI, Molecular Probes) at 1 μg/ml ...
-
bioRxiv - Cell Biology 2021Quote: ... DAPI was used (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, 1:10 000, Invitrogen).
-
bioRxiv - Cell Biology 2020Quote: ... Nuclei were staining with DAPI (4′,6-diamidino-2-phnylindole) from Molecular Probes. Confocal images were acquired using a Leica Sp8 confocal microscope and processed using Imaris image analysis software (version 9.3.1).
-
bioRxiv - Cancer Biology 2022Quote: ... sulfosuccinimidyl 6-(4’-azido-2’-nitrophenylamino)hexanoate (sulfo-SANPAH; 22589, Thermo Fisher Scientific), 3-(Acryloyloxy)propyltrimethoxysilane (L16400 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and anti-G3BP-2 (Invitrogen, PA5-53776; at a 6 : 10 000 dilution), followed by three 2-min washes with room-temperature TBST ...
-
bioRxiv - Immunology 2022Quote: ... Nuclei were stained with 4′-6-diamidino-2-phenylindole (DAPI) dihydrochloride (Life Technologies), and lung sections were mounted on glass microscopy slides using fluorescence mounting medium (Dako) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5-(and-6)-chloromethyl-2′,7′ dicholorodihydrofluorescein diacetate (CM-H2DCFDA; Molecular Probes C6827), was used to visualize ROS accumulation (excitation ...
-
bioRxiv - Immunology 2022Quote: ... or 2.5μM of 5-(and-6)-Carboxy-2’,7’-Dichlorofluorescein Diacetate (DCFDA) (Invitrogen) was then added and incubated with the cells 20 minutes at 37°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... stained with 4’,6-diamidino-2-phenylindole (DAPI, 0.1 μg/mL; #D1306, Invitrogen) and mounted with Prolong Gold antifade medium (#P10144 ...
-
bioRxiv - Microbiology 2021Quote: ... 6-diamidino-2-phenylindole (DAPI; Life technology) and mounted with antifade reagent (Invitrogen). The fluorescence microscopic images were acquired using the Leica TCS SP5 confocal microscope (Leica Microsystems ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were counterstained using 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) to visualize the nuclei ...
-
bioRxiv - Neuroscience 2022Quote: ... incubated with 4′,6-diamidino-2-pheny-lindoldihydrochloride (DAPI, Thermo Fisher Scientific #D3571) diluted in DPBS for 10 minutes ...
-
bioRxiv - Cell Biology 2022Quote: Live cells were stained with Laurdan dye (6-dodecanoyl-2-dimethylaminonaphthalene) (Thermo Scientific) at 15 μM for 45 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... Sections were counterstained with DAPI (4′,6-diamidino-2-phenylindole dihydrochloride; Molecular Probes). Pictures were taken using a TCS SP5 Inverted confocal (Leica ...
-
bioRxiv - Genetics 2021Quote: ... Tissue slides were also stained with DAPI (4′,6-diamidino-2-phenylindole, Invitrogen) to visualize the total number of nucleated myocardial cells within each section ...
-
bioRxiv - Neuroscience 2021Quote: ... Brain slices were incubated in 4’,6-diamidino-2-phenylindole (DAPI, Acros Organics–Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were counterstained using 4’,6-Diamidino-2-Phenylindole (DAPI – Life Technologies, D1306) diluted in PBS before being mounted on microscope slides with ProLong Gold Antifade Mountant (Life Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... 6 dpf/2 dpi larvae were pulsed with 2.5 nM EdU (Thermo Fisher) for 1h and chased for a further 1.5 h prior to fixation ...
-
bioRxiv - Genomics 2021Quote: ... the DNA was counterstained with DAPI (4′,6-diamidino-2-phenylindole, ThermoFisher Scientific) diluted 1:10,000 with PBST ...
-
bioRxiv - Cell Biology 2021Quote: ... Fluoromount-G mounting medium with 4′,6-diamidino-2-phenylindole (Invitrogen, Waltham, MA) was used to mount the samples.
-
bioRxiv - Neuroscience 2021Quote: ... and 1:500 dilution of DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (ThermoFisher). The brain slices were washed 3x with 1XPBS and then mounted with mounting media (Fluoro-Gel ...