Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for 7H Diimidazo 1 5 a 1 5 4 de quinoxaline 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... 1 x 5 minutes) and mounted in SlowFade Diamond (Thermo Fisher S36972). For the overnight steps ...
-
bioRxiv - Immunology 2020Quote: ... and cultured (5-10 x 105 cells ml-1) in RPMI (GIBCO) supplemented with 15% FBS (Hyclone ...
-
bioRxiv - Immunology 2022Quote: ... 5% 1M HEPES and 1% gentamicin (all Thermo Fisher Scientific, Waltham, MA). For Vero E6 cells ...
-
bioRxiv - Cancer Biology 2020Quote: ... supplemented with 5% fetal bovine serum and 1% Glutamax (Thermo Fisher Scientific). 293T cells were cultured in DMEM medium supplemented with 10% FBS ...
-
bioRxiv - Neuroscience 2021Quote: ... Cy-5-coupled goat anti-rabbit (ThermoFisher A-10523; diluted 1:500), Cy-3-coupled goat anti-guinea pig (Abcam ab102370 ...
-
bioRxiv - Microbiology 2020Quote: ... 1~5 μg RNA were reverse-transcribed using RevertAid transcriptase (Thermo Scientific) and random hexamer ...
-
bioRxiv - Immunology 2020Quote: Cells were loaded with 5 μg/mL Indo-1 AM (Life Technologies) and stained with lineage markers for 15 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... 5% fetal bovine serum (FBS) and 1 % penicillin/streptomycin (Gibco, Life Technologies,
-
bioRxiv - Immunology 2020Quote: ... The 2× RT mastermix contained 1 μl 5× SuperScript II buffer (Thermofisher), 0.25 μl 100 mM DTT (Thermofisher) ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μg of FGFb Recombinant Human Protein and 1% Gluta-MaxTM (Gibco) in flasks coated with Matrigel Matrix Basement Membrane (Corning ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μg/ml blasticidin (Melford Laboratories) or 1 mg/ml G418 (Invitrogen) as appropriate.
-
bioRxiv - Microbiology 2022Quote: ... The homogenate was diluted 1/5 in Opti-MEM (Thermo Fisher Scientific) and centrifuged at 17.000g for two minutes to pellet cell debris ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with 5% FBS and 1 mg/mL geneticin (Gibco #10131-035). Calu-3 2B4 (BEI Resources # NR-55340 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 mL penicillin/streptomycin (1% final concentration, Thermo Fisher Scientific, 15140-122).
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 mL penicillin/streptomycin (1% final concentration, Thermo Fisher Scientific, 15140-122), 5 mL L-glutamine (2mM final concentration ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 mL penicillin/streptomycin (1% final concentration, Thermo Fisher Scientific, 15140-122), 5 mL L-glutamine (2mM final concentration ...
-
bioRxiv - Microbiology 2023Quote: ... 5 g l-1 low-melting agarose (Thermo Scientific, Waltham, MA, USA)) and 300 μl overnight bacterial culture ...
-
bioRxiv - Molecular Biology 2023Quote: ... resuspended in 1 ml of 5% trichloroacetic acid (SA433, Thermo Fisher Scientific) and incubated at 4°C for a minimum of 10 min ...
-
bioRxiv - Genomics 2023Quote: ... (5) A combination of 1 µL GlycoBlue (Cat#AM9515, Thermo Fisher Scientific), 100 μL of 3 M sodium acetate (pH 5.2) ...
-
bioRxiv - Neuroscience 2023Quote: ... and blocked in 1 % PBS-T containing 5 % normal goat serum (ThermoFisher) for 2 h ...
-
bioRxiv - Genomics 2023Quote: ... supplemented with 5% Charcoal Striped Serum (Biowest) and 1% penicillin-streptomycin (Gibco) before being transfected with the cloned ERα-focused STARR-seq capture library using polyethylenimine (Polysciences) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and treated with 1 mM 5-ethynyl uridine (ThermoFisher, Catalog No. C10330) for 20 min ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... SLC6S4/5-HTT (rabbit, 1:100 dilution, Thermo Fisher Scientific PA5-49572). Following immunostaining ...
-
bioRxiv - Neuroscience 2024Quote: ... coverslips were incubated with 1 µM NeutrAvidin for 5 min (Invitrogen, A2666), followed by 10 nM biotinylated anti-GFP antibody for 15 min (ABCAM ...
-
bioRxiv - Molecular Biology 2019Quote: ... and incubated with primary antibodies (anti-ZO-1, 1:50, Life Technologies; anti-occludin, 1:50, Life Technologies; anti-claudin-5, 1:50, Life Technologies;) respectively at 4°C overnight ...
-
bioRxiv - Genomics 2019Quote: ... 1 µg of each of the samples was combined with 5 µg Cot-1 DNA (15279011, ThermoFisher) and 1 µl of 1mM blocking oligo (5’ AGGTTAAACACCCAAGCAGACGCCGCAATATCAGCACCAACAGAA 3’ ...
-
bioRxiv - Systems Biology 2020Quote: ... RNA was radioactively 5' end-labeled using 1 U μl−1 T4 polynucleotide kinase (Thermo Fisher Scientific) and 0.5 μCi μl−1 32P-γ-ATP (PerkinElmer ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 μl 10 μM 5‘-biotinylated oligo-dT30VN (IDT) and 1 μl 10 mM dNTP (Thermo Scientific). Cells were sorted at one cell per well ...
-
bioRxiv - Immunology 2019Quote: ... neutrophils were loaded with 5 μM Fluo-4 AM (Thermo Fisher) and incubated at 37°C for 30 min ...
-
bioRxiv - Neuroscience 2020Quote: ... or 4′,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were included in the secondary antibody solution to stain nuclei.
-
bioRxiv - Cancer Biology 2021Quote: ... Excess cells were washed off with PBS (4×5 mL, Gibco), briefly left in RPMI (5 mL ...
-
bioRxiv - Neuroscience 2021Quote: ... The cells were loaded with 5 μM fluo-4 AM (Invitrogen) in Hanks’ balanced salt solution (HBSS ...
-
bioRxiv - Neuroscience 2023Quote: ... or 4°,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were added during the first wash step to visualize nuclei ...
-
bioRxiv - Cell Biology 2023Quote: ... 4-5 μl Page Ruler Pre-stained Protein Ladder (Thermo Scientific), and 10 μl of 4X Dye (last three grooves ...
-
bioRxiv - Biochemistry 2020Quote: ... De-phosphorylated tsRNA or synthetic RNA (scrambled) were 5’-thiolated by incubation with 0.5 U/µL polynucleotide kinase (ThermoFisher Scientific) in the presence of 0.5 mM ATPγS (SIGMA ...
-
bioRxiv - Cell Biology 2022Quote: ... at 37°C in a 5% CO2 incubator with daily media changes and were passaged every 4-5 days using TrypLETM (ThermoFisher), following manufacturer’s recommendations ...
-
bioRxiv - Immunology 2020Quote: ... purified B cells were incubated at 6 × 106 cells ml-1 in 1 mL of PBS with 1 uL of 5 mM Cell Trace Violet (CTV) dye (Thermo Scientific). The CTV-stained B cells were washed and activated as detailed above and subjected to flow cytometry analyses 4 days after activation.
-
bioRxiv - Microbiology 2023Quote: ... Transfection was performed with 5 µg of pLKO.1 puro pri-mir-1-1 vector using Lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... and shRNA plasmids or pCDH plasmids by PEI-40000 with the ratio of 5: 1: 5 in opti-MEM (Gibco, Thermo Fisher Scientific). Virions were collected after 48 h after transfection ...
-
bioRxiv - Molecular Biology 2019Quote: ... supplemented with protease inhibitors (1 mM PMSF, 5 μg/ml aprotinin and 5 μg/ml leupeptin, #78443, Thermo Fisher Scientific, Waltham, MA). Fifty ul of Dynabeads Protein A/Protein G (#10015D ...
-
bioRxiv - Cell Biology 2020Quote: ... organoids (after 1 week of culture) were incubated (37°C, 5% CO2, 1 h) with 10 µM EdU (5-ethynyl-2’-deoxyuridine, Thermo Fisher Scientific), a nucleoside analog of thymidine incorporated into DNA during active DNA synthesis ...
-
bioRxiv - Immunology 2022Quote: ... targeting SAMHD1 (sense RNA 5’-GCAGAUAAGUGAACGAGAUTT-3’, antisense RNA 5’-AUCUCGUUCACUUAUCUGCAG-3’) or the negative control #1 siRNA using RNAiMAX (ThermoFisher, 13778-075). 24 h after transfection ...
-
bioRxiv - Molecular Biology 2022Quote: ... and incubating at 37°C in a 5% CO2 humidified incubator in DFGM supplemented with 5 ng mL−1 TGF-β1 (Thermo Fisher Scientific) and 100 μg mL−1 ascorbic acid ...
-
bioRxiv - Systems Biology 2023Quote: ... Cells were again washed 3x with 1 mL DPBS for 5 min each followed by nuclear labeling for 5 min with 1 mL 300 nM DAPI dissolved in DPBS (Thermo Fisher Scientific) and a 5-min DPBS wash ...
-
bioRxiv - Microbiology 2024Quote: ... each culture was diluted 1:1000 in BHI + 5% yeast and 10μl were streaked on a BHI + 5% yeast agar (Thermo Fisher Scientific, CM1136) plate ...
-
bioRxiv - Microbiology 2024Quote: ... was added at a 1:2000 dilutions for 1 h at 37 °C, followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Fisher Scientific) for 30 min ...
-
bioRxiv - Immunology 2024Quote: Analysis of cytokines and chemokines from sera and lungs homogenates collected 5 dpi and 5 dpc were conducted using the ProcartaPlex TM Mouse Cytokine & Chemokine Convenience Panel 1 26-plex (Thermo Fisher Scientific) following the manufacturer’s specifications ...
-
bioRxiv - Neuroscience 2020Quote: ... and then incubated at room temperature for 4-5 h in Triton PBS containing Alexa Fluor 594-conjugated donkey anti-rabbit IgG (1:1000; A-21207, Thermo Fisher Scientific, RRID:AB_141637). After binding of streptavidin/antibodies ...
-
bioRxiv - Microbiology 2022Quote: ... The in vitro transcription reaction for the 5’ cap driven Fluc reporter included a 1:4 ratio of Invitrogen™ Anti-Reverse Cap Analog (Fisher Scientific AM8045) and GTP solution (0.4 µl cap analog to 1.6 µl of GTP solution) ...
-
bioRxiv - Neuroscience 2023Quote: ... the sections were incubated over-night at 4°C with the following primary antibodies: mouse anti-claudin-5 (Invitrogen, USA, 1:100 dilution) and rabbit anti-occludin (Invitrogen ...