Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for 7 Chlorothieno 2 3 c pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Cellular reactive oxygen species (ROS) levels were detected using 2’,7’ dichlorodihydrofluorescein diacetate (H2DCFDA; Invitrogen). Cells were treated in the absence or presence of drugs for 48 hours ...
-
bioRxiv - Bioengineering 2022Quote: ... Spheroid viability was evaluated at days 1 and 7 via Calcein AM (Invitrogen, 2 µM) and ethidium homodimer (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... the conversion of non-fluorescent 2’,7’-bis-(2- carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethyl ester (BCECF AM) (Invitrogen, Waltham, MA) into a pH sensitive fluorescent indicator by the intracellular esterase was used to measure the pH ...
-
bioRxiv - Neuroscience 2024Quote: Intracellular ROS in BV-2 cells was measured by incubating cells with 1 µM cell-permeant 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA, Invitrogen, D399) at 37°C for 30 min.
-
bioRxiv - Systems Biology 2023Quote: ... 30 s at 72 °C and a final step of 7 min at 72 °C using a GeneAmp 2400 (Applied Biosystems, Foster City, CA, USA) thermal cycler ...
-
bioRxiv - Cell Biology 2022Quote: ... we used 7-AAD (7-Aminoactinomycin D) (Thermofisher, # A1310) or FxCycle™ PI/RNase Staining Solution (Thermofisher ...
-
bioRxiv - Genomics 2020Quote: ... 7-Aminoactinomycin D (7-AAD) (1:200 dilution, ThermoFisher Scientific #A1310 ...
-
bioRxiv - Neuroscience 2022Quote: ... 7-aminoactinomycin D (7-AAD, Thermo Fisher, A 1310) was added 1:50 as a cell death marker.
-
bioRxiv - Molecular Biology 2019Quote: ... the PCR products obtained with 2 primers (AV48_SMCHD1_gPCR_F: 5’-AGGAGCGCGTTTGAATCGG-3’, AV47_SMCHD1_gPCR_R 5’-CTTCGCGTACCTGACACACAC-3’) were TOPO-cloned (Thermo Fisher, #450071) and sent for sequencing.
-
bioRxiv - Microbiology 2020Quote: ... at 4 °C for 3 h on a Labquake rotator (ThermoFisher Scientific). The beads were washed with 1 mL cold lysis/binding buffer four times at 300 g for 4 min at 4 °C ...
-
bioRxiv - Microbiology 2024Quote: ... for 1h at 37°C and then with 3 µM DAPI (Invitrogen) for 20 min ...
-
bioRxiv - Plant Biology 2020Quote: ... on 4-16% (Figures 4A and 7) or 3-12% (Figures 4C and 6) NativePAGE gels (Life technologies). Cathode Running buffer (Life technologies ...
-
bioRxiv - Bioengineering 2021Quote: ... Apoptosis was detected by incubating devices with 5μM of CellEvent™Caspase 3/7 Green detection reagent (Invitrogen) for 30 minutes at 37°C.
-
bioRxiv - Bioengineering 2022Quote: ... Samples were incubated for 30 min in standard media with CellEvent Caspase 3/7 (1:400, C10423, Invitrogen) prior to imaging to observe apoptosis.
-
bioRxiv - Immunology 2020Quote: ... splenic NP366-374 TMEM were assessed with CellEvent™ Caspase-3/7 Green Flow Cytometry Assay kit (ThermoFisher). Lung single cells were stained with surface markers then incubated with caspase 3/7 green detection reagent for 30 minutes at 37°C as described in the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: Live/Dead™ Cell Imaging Kit and CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific) were used for detection of cell apoptosis based on the manufacturer instructions ...
-
bioRxiv - Immunology 2023Quote: ... 10% H2/N2 (BOC) for 3 days on blood agar plates containing 7% laked horse blood (Thermo Scientific) and the Campylobacter selective supplement “Skirrow” containing the antibiotics trimethoprim ...
-
bioRxiv - Biochemistry 2021Quote: ... The protein was run over either one (at 10°C) or two (at 10°C and 2°C) immobilized pepsin columns (Applied Biosystems; Poroszyme Immobilized Pepsin Cartridge ...
-
bioRxiv - Cell Biology 2021Quote: ... COS-7 cells (ATCC) were grown at 37°C with 5% CO2 in Dulbecco’s modified Eagle’s medium (Gibco) containing 10% fetal bovine serum and 1% penicillin/streptomycin (Invitrogen) ...
-
bioRxiv - Biochemistry 2023Quote: ... This solution was incubated for 1h at ~7°C with 0.25 ml of HisPur Cobalt resin (Thermo Scientific). The beads were allowed to settle to the bottom of a protein purification column and washed 5 times with 10 ml of washing buffer comprising 10 mM imidazole and 0.1% Triton X-100 in 2xPBS ...
-
bioRxiv - Immunology 2024Quote: ... were cultured for up to 7 days at 37°C in 5% CO2 in RPMI 1640 media (Gibco) supplemented with 10% Heat Inactivated FBS (Gibco ...
-
bioRxiv - Genomics 2022Quote: ... 3 μM CHIR99021 (Stemgent) and 0.5× N-2 Supplement (Gibco)) which was changed daily for the cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... and were purified 2-3 times by Trizol LS (Ambion) to completely remove the carry over plasmid DNA template ...
-
bioRxiv - Neuroscience 2024Quote: ... with passaging every 2-3 days with trypsin/EDTA (Gibco). 3 biological replicates were generated for proteomic analysis ...
-
bioRxiv - Plant Biology 2020Quote: ... cinerea germlings exposed to different concentrations NCR044.1 was measured every 30 min for 2 h using the ROS indicator dye 2′,7′-dichlorodihydrofluorescein diacetate (H2DCF-DA, Invitrogen, Carlsbad, CA). ROS levels were quantified by measuring the fluorescence in a SpectraMax® M3 spectrophotometer microplate reader (exc ...
-
bioRxiv - Physiology 2021Quote: ... HUVECs were washed 2 × with D-PBS and loaded with DAF-FM™ diacetate (4-amino-5-methylamino-2′,7′-difluorofluorescein diacetate; Molecular Probes, Invitrogen) to a final concentration of 1 µM in KRH buffer and incubated at 37°C for 45 minutes protected from light ...
-
bioRxiv - Cell Biology 2022Quote: ... 2’,7’-Bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM) was purchased from Molecular Probes (Invitrogen, Carlsbad, CA, USA). Fluorescein isothiocyanate (FITC)- and tetramethylrhodamine (TRITC)-conjugated goat anti-mouse and rabbit IgG antibodies were purchased from Jackson ImmunoResearch (West Grove ...
-
bioRxiv - Developmental Biology 2022Quote: ... 7-amino-actinomycin (7-AAD, ThermoFisher, for labeling nonviable cells) stained cells were sorted using a FACS Aria II sorter (BD BioSciences) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were stained with 7-amino-actinomycin (7-AAD, ThermoFisher) to label nonviable cells and then sorted using a FACS Aria II sorter (BD BioSciences ...
-
bioRxiv - Microbiology 2020Quote: ... for 2 h at 37 °C in opti-MEM (Gibco). Cells were washed 3x after transfection with media ...
-
bioRxiv - Neuroscience 2022Quote: ... for 2 days at 4 °C (Invitrogen, both 1:500). After washing ...
-
bioRxiv - Cell Biology 2020Quote: Cellular ROS production was measured using a CM-H2DCFDA (2’,7’-dichlorofluorescein diacetate) (Life Technologies, USA) assay kit ...
-
bioRxiv - Immunology 2021Quote: ... 1 × 105 activated NKT cells were incubated with 1 mM 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA) (Invitrogen) in RPMI complete media for 30 minutes at 37°C ...
-
bioRxiv - Biochemistry 2019Quote: ... 4-amino-5-methylamino-2’,7’-difluorofluorescein diacetate (DAF-FM DA; Molecular Probes, Eugene, OR, USA) was used to detect NO production in sorghum genotype stalks in response to inoculation treatment at 7 DPI ...
-
bioRxiv - Cancer Biology 2020Quote: ... HBEC3-KT cells were incubated with 1 μM of 2’-7’-dichlorofluorescin diacetate (CM-H2DCFDA; Invitrogen) for 30 min at 37°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR was performed using 2× Power SYBR green reagents on the QuantStudio 7 Thermocycler (Life Technologies).
-
bioRxiv - Molecular Biology 2021Quote: Striatal ROS was marked by 2’ 7’-dichlorodihydrofluorescein diacetate (Molecular Probes™ H2DCFDA (H2-DCF, DCF), ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... intracellular ROS and GSH levels in keratinocytes were measured using H2DCFDA (2’, 7’- dichlorodihydrofluorescein diacetate; Invitrogen) and CellTracker Blue (4-chloromethyl- 6.8- difluoro- 7- hydroxycoumarin ...
-
bioRxiv - Physiology 2023Quote: ... followed by 7 days of decalcification with Shandon’s TBD-2 (Thermo Fisher Scientific, Waltham, MA, USA) at room temperature ...
-
bioRxiv - Biochemistry 2024Quote: ... Fluorescent probes dihydroethidine and 2’,7’-dichlorodihydrofluorescein diacetate were obtained from Molecular Probes (Eugene, Oregon, USA).
-
bioRxiv - Cancer Biology 2021Quote: ... and an HA-tag was added by using AgeI-and NotI-restriction site containing primers (forward: 5’-ATTAACCGGTGCCACCATGCCCCAGCTCG-3’; revers: 5’-TAATGCGGCCGCTTAAGCGTAATCTGGAACATCGTAGTGGGCAGACTTGGTGACC −3’) and a final Tm of 65 °C (Phusion Polymerase, ThermoFisher), before cloning it into the multiple cloning site of a modified pTP vector47 ...
-
bioRxiv - Cell Biology 2021Quote: ... The Stim coding sequence was cloned by PCR using primers 5’-CAC CAT GCG AAA GAA TAC CAT TTG GAA C-3’ and 5’-TTC CGT GGC AAG CAG CGA AAA GTT C-3’ and ligated into pENTR/D-TOPO (Invitrogen). Site-directed mutagenesis (Stratagene QuikChange XL ...
-
bioRxiv - Immunology 2021Quote: ... 7-AAD (Invitrogen), Live/dead fixable viability dye (Invitrogen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 3×(CAC)2 and (CAC)2 RNAs were transcribed using T7 RNA polymerase (Thermofisher Scientific). A 10 μl binding reaction contains 10 nM RNA ...
-
bioRxiv - Genomics 2020Quote: ... The purified RNA samples were quantified using Qubit RNA reagent kit on a Qubit fluorometer 3.0 (concentration range 3-7 ng/μl) (Invitrogen). RNA integrity (RINe ...
-
bioRxiv - Genomics 2020Quote: ... media were replaced with 100 μL full melanoma media without phenol-red containing 4μM Caspase-3/7 activity dye (CellEvent, ThermoFisher). Plates where imaged using a Celigo Imaging Cytometer (Nexcelom ...
-
Multi-Omic Analysis Reveals Disruption of Cholesterol Homeostasis by Cannabidiol in Human Cell LinesbioRxiv - Systems Biology 2021Quote: ... seeded with 2,000 cells/well and stained with Hoescht 33258 (1µg/mL) and CellEvent Caspase-3/7 Green Detection Reagent (ThermoFisher) at a dilution of 1000x ...
-
bioRxiv - Immunology 2020Quote: ... 1×106 CAR T cells were co-cultured with γ-irradiated K562-CD19 or K562-CD19-PD-L1 at 1:3 effector:target (E:T) ratio for 7 days and counted with the countess II Automated Cell Counter (ThermoFisher, USA).
-
bioRxiv - Cell Biology 2022Quote: ... 2007) and DsRed2-Mito (Tanaka Bio) plasmids using a ratio of 7:3 using Lipofectamine LTX Plus (ThermoFisher, 15338100) for 5 hours ...
-
bioRxiv - Cancer Biology 2022Quote: ... alongside aforementioned activating proteins and CellEvent™ Caspase-3/7 Green Detection Reagent (1:5000, ThermoFisher Scientific, Cat#C10423). Cells were imaged using the IncuCyte ZOOM System (Essen Bioscience ...