Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for 7 Benzothiazolemethanol 2 amino 6 methoxymethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... followed by 6 column volumes of elution buffer (2× GIBCO 14200-075 PBS ...
-
bioRxiv - Biophysics 2020Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed for actin cytoskeleton and nucleus staining ...
-
DNA uptake by cell wall-deficient bacteria reveals a putative ancient macromolecule uptake mechanismbioRxiv - Microbiology 2022Quote: ... 10 mM Laurdan (6-Dodecanoyl-2-Dimethylaminonapthalene) stock solution (Invitrogen) was prepared in 100% dimethylformamide (DMF ...
-
bioRxiv - Cancer Biology 2020Quote: ... SSC and DAPI (4’,6-diamino-2-phenylindole) (Fisher Scientific) staining profiles ...
-
bioRxiv - Physiology 2021Quote: ... 6-diamidino-2-phenylindole (DAPI) was used (Invitrogen; 1:5000).
-
bioRxiv - Physiology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:1000, Thermo Fisher Scientific). The stains were analyzed using a microscope (Zeiss ...
-
bioRxiv - Neuroscience 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:1000, Thermo Fisher Scientific). The stains were analyzed using a microscope (Zeiss ...
-
bioRxiv - Bioengineering 2019Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, NucBlue Fixed, Life Technologies) for cell count and nuclear aspect ratio ...
-
bioRxiv - Neuroscience 2019Quote: ... counterstained with 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI;ThermoFisher) and mounted with Vectashield H1400 Hardset Mounting Medium (Vector Labs) ...
-
bioRxiv - Molecular Biology 2020Quote: ... pH 6 using a 2 kDa MWCO dialysis unit (ThermoFisher). Heats of binding were measured using a MicroCal iTC200 calorimeter (GE Healthcare ...
-
bioRxiv - Cell Biology 2019Quote: ... DAPI (4’,6-diamino-2-phenylindole, Life Technologies, Ref#D3571) and Calcein AM staining profiles and Calcein AM (Life Technologies ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... containing 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen, Cat # P36935), and analyzed by LSM510 Meta Laser or Leica TCS SPE confocal microscopes (× 63 glycerol immersion objectives ...
-
bioRxiv - Cell Biology 2021Quote: ... 6 - diamidino-2-phenylindole (DAPI, 5 µg/ml, Life Technologies).
-
bioRxiv - Cell Biology 2021Quote: ... and 4′,6-diamidino-2-phenylendole (DAPI; 1:5000, Invitrogen) or Hoechst (1:10,000 ...
-
bioRxiv - Neuroscience 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:1000, Thermo Fisher Scientific). The staining was visualized using a microscope (Zeiss ...
-
bioRxiv - Cancer Biology 2022Quote: ... DAPI (4′,6-Diamidino-2-Phenylindole; Thermo Fisher Scientific, D1306),
-
bioRxiv - Biophysics 2022Quote: ... and 6-Dodecanoyl-2-Dimethylaminonaphthalene (Laurdan) were purchased from ThermoFisher Scientific Ltd ...
-
bioRxiv - Cancer Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) for nuclear detection (ThermoFisher MA). For live-cell imaging ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, Invitrogen Cat. D1306), was added ...
-
bioRxiv - Microbiology 2023Quote: ... stained with 4’,6-diamidino-2-phenylindole (DAPI, Thermo Scientific) and LACV antibody as described below ...
-
bioRxiv - Microbiology 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, ThermoFisher Scientific, Waltham, MA) was used to label nuclei ...
-
bioRxiv - Cancer Biology 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole) was from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... with 4′,6-diamidino-2-phenylindole (DAPI; ThermoFisher, 1:5000) were applied in blocking solution for 1h at RT on an orbital shaker ...
-
bioRxiv - Cell Biology 2023Quote: ... 4’,6’-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, D1306) was utilized to detect the nuclei ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher Scientific - D1306) was used 1:10000 ...
-
bioRxiv - Cell Biology 2024Quote: ... DAPI (4′,6-diamidino-2-phenylindole, dihydrochloride, 1:10,000, Invitrogen) was used as a DNA counterstain together with the secondary antibody ...
-
bioRxiv - Microbiology 2023Quote: ... Counterstaining was with 4’-6-diamidino-2-phenylindole (DAPI) (Invitrogen) at 20 µg/mL ...
-
bioRxiv - Biochemistry 2023Quote: ... DAPI (4’,6-Diamidin-2-phenylindol, Dihydrochloride; Thermo Fisher Scientific) staining was performed prior to recording ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher D1306) and stored in the dark at 4°C until imaging.
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:10000, Thermo Fisher Scientific). Semi-quantitative methods were utilized for analysis ...
-
bioRxiv - Microbiology 2024Quote: ... 6’-diamidino-2 phenylindole (DAPI; Cat. P36941, Invitrogen, Carlsbad, CA) and visualized on a Leica Stellaris confocal microscope using a 63x oil immersion objective ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human Drosha cDNA with a Flag-tag at the amino-terminus and a 6 x his tag at the carboxyl-terminus was cloned into pcDNA4/TO (Invitrogen) to construct the inducible WT Drosha expressing plasmid for immunoprecipitation assay and ubiquitination assay ...
-
bioRxiv - Neuroscience 2023Quote: ... brains were washed trice with PBS for 5 min and free amines were anchored with 0.1mg/mL succinimidyl ester of 6-((Acryloyl)amino)hexanoic acid (Acryloyl-X, SE, Life Technologies) in PBS at 4°C overnight ...
-
bioRxiv - Bioengineering 2023Quote: ... All samples were then incubated with 4′,6-Diamidino-2-phenylindole (DAPI, 2 µM, Thermofisher) as a nuclear counterstain and Alexafluor 555 phalloidin (1:60 ...
-
bioRxiv - Plant Biology 2020Quote: ... on 4-16% (Figures 4A and 7) or 3-12% (Figures 4C and 6) NativePAGE gels (Life technologies). Cathode Running buffer (Life technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... Larval zebrafish at 6-7 dpf were paralyzed by immersion in 1 mg/ml alpha-bungarotoxin solution (Invitrogen) dissolved in external solution (in mM ...
-
bioRxiv - Neuroscience 2022Quote: ... Tax ID 10090) protein database (2017-6-7) using Proteome Discoverer (PD) 2.2 (Version 2.2.0.388; Thermo Fisher Scientific). Label-free quantification was also performed with PD 2.2 using precursor ions quantifier nodes ...
-
bioRxiv - Genomics 2021Quote: ... qPCR was performed on Viia 6/7 Real time PCR system using SYBR Green master mix (Life Technologies). The primers used are listed in Supplementary table 1 ...
-
bioRxiv - Cell Biology 2021Quote: ... These experiments were carried out with the QuantStudio 6 and 7 Flex Real-Time PCR Systems (Applied Biosystems). Expression of circRNAs was calculated relative to the housekeeping genes 18S or ACTB ...
-
bioRxiv - Bioengineering 2023Quote: ... HUVECs were cultured for 6-7 days prior to detachment with 0.25% trypsin-EDTA (Life Technologies, 25200-056) for use in experiments ...
-
bioRxiv - Bioengineering 2023Quote: ... HUVECs were cultured for 6-7 days prior to detachment with 0.25% trypsin-EDTA (Life Technologies, 25200-056) for use in experiments.
-
bioRxiv - Plant Biology 2024Quote: ... Data was analysed with QuantStudio 6 and 7 Pro Real-Time PCR Systems Software (Thermo Fisher Scientific, America). For RT-qPCR ...
-
bioRxiv - Cell Biology 2024Quote: ... Z-stack images were taking on day 6-7 after seeding using EVOS™ 7000 Imaging System (Invitrogen). and used for quantification of organoids.
-
bioRxiv - Bioengineering 2020Quote: ... the cell pellets were incubated for an hour in 2 uM 2’,7’-dichlorodihydrogen-fluorescein diacetate (H2DCF-DA, Invitrogen) in phenol red free media (Sigma ...
-
bioRxiv - Physiology 2023Quote: ... IL-6 and FFA content were measured by ELISA (IL-1β, Biolegend, 432604; IL-6, Invitrogen, BMS603-2) or a FFA fluorometric kit (Cayman Chemical ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Biophysics 2021Quote: ... accessed 6/18/2019) and the pepsin amino acid sequence using Proteome Discoverer software (version 1.3, SEQUEST algorithm, Thermo Fisher Scientific) or Byonic software (Protein Metrics ...
-
bioRxiv - Microbiology 2021Quote: ... nonessential amino acids (Gibco), 2 mM L-glutamine (Invitrogen) ...
-
bioRxiv - Developmental Biology 2022Quote: ... nonessential amino acids (Gibco), L-glutamine (Gibco) ...
-
bioRxiv - Immunology 2020Quote: ... nonessential amino acids (Gibco), 2-mercaptoethanol (Gibco) ...