Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for 6H Imidazo 4 5 e 2 1 3 benzothiadiazole 7 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... CellEvent Caspase-3/7 Green ReadyProbes™ Reagent (Invitrogen, R37111) was used ...
-
bioRxiv - Molecular Biology 2024Quote: ... a Caspase-3/7 assay kit was used (Invitrogen, C10427). Each tube was brought to a volume of 1 ml staining buffer and 1 μl of CellEvent Caspase-3/7 reagent was added ...
-
bioRxiv - Immunology 2021Quote: ... 5% CO2 in Williams’ E medium (with Glutamine) (Gibco-Invitrogen) supplemented with glutamine (2 mM) ...
-
bioRxiv - Immunology 2021Quote: ... 5% CO2 in Williams’ E medium (with Glutamine) (Gibco-Invitrogen) supplemented with glutamine (2 mM) ...
-
bioRxiv - Cell Biology 2021Quote: ... THP-1 cells (1.5×105 cells/mL) were labeled with a fluorescent dye 2’,7’-bis(carboxyethyl)-5 (6)-carboxyfluorescein-AM (Thermo Fisher Scientific B1150; 1 mg/mL) in serum-free RPMI medium (Thermo Fisher Scientific 11875093 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 200µl of 2’,7’ – dichlorofluorescindiacetate (H2DCFDA) (Invitrogen, ab113851) was added in each well and the plate was incubated at 37°C in the dark ...
-
bioRxiv - Molecular Biology 2023Quote: For 2′,7′-dichlorodihydrofluorescein diacetate (H2DCFDA, Invitrogen(tm) Cat ...
-
bioRxiv - Cell Biology 2024Quote: ... 2’,7’-dichlorodihydrofluorescein diacetate (H2DCF-DA, D399, Invitrogen), dihydroethidine (DHE ...
-
bioRxiv - Microbiology 2023Quote: Vero E6 cells were transfected with 400 ng/well 2-E plasmids or 2-E mutations using Lipofectamine 3000 Transfection Reagent (L3000015, Thermo Fisher, MA, USA). The control group was Vero E6 cells transfected with 400 ng/well pcDNA3.1 vector plasmids alone ...
-
bioRxiv - Biochemistry 2022Quote: ... to final concentration 0.5 mg/ml protein and 6x dye and heated from 10 to 70 °C with fluorescence reading every 0.1 °C (4 to 5 sec) in a QuantStudioTM 7 Flex Real-Time PCR System (Life Technologies). Protein thermal melting curve were generated using the Protein Thermal Shift TM software ...
-
bioRxiv - Biochemistry 2024Quote: HEK293 cells with Fzd1/2/4/5/7/8 knocked out were provided by Michael Boutros (Voloshanenko et al., 2017) and maintained in DMEM (Gibco) supplemented with 10% fetal bovine serum (Gemini) ...
-
bioRxiv - Cell Biology 2021Quote: ... washed 3 times and incubated with 4’,6-Diamidino-2-phenylindole (DAPI; 2mg/ml) (Invitrogen) in PBS for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... After washing and nuclear counterstaining with 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher, 3 µM), sections were mounted on microscopic slides using Aqua Poly/Mount (Polysciences) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the full volume of media in each well was pipetted gently 4-5 times and added to 1 mL of FACS buffer containing 3 uM DAPI (PBS pH 7.4, 2–5 mM EDTA, 0.1% BSA, 3 uM DAPI (Thermo Scientific #62247)) ...
-
Turanose induced WOX5 restores symbiosis in the Medicago truncatula cytokinin perception mutant cre1bioRxiv - Plant Biology 2020Quote: ... and immersed and incubated in the dark in staining solution 1 mM 5-bromo-4-chloro-3-indolyl-β-D-glucuronicacid (X-Gluc, Thermo Scientific), 50mM sodium phosphate buffer ...
-
bioRxiv - Molecular Biology 2019Quote: One microgram of peptides in a volume of 1-4 μL was loaded onto the Acclaim μ-Precolumn (0.5 mm х 3 mm, 5 μm particle size, Thermo Scientific) at a flow rate of 10 μL/min for 4 min in an isocratic mode of Mobile Phase C (2% MeCN ...
-
bioRxiv - Biochemistry 2021Quote: ... One microgram of peptides in a volume of 1-4 µL was loaded onto the Acclaim µ-Precolumn (0.5 mm х 3 mm, 5 µm particle size, Thermo Scientific) at a flow rate of 10 µL/min for 4 min in an isocratic mode of Mobile Phase C (2% acetonitrile (Sigma-Aldrich) ...
-
bioRxiv - Plant Biology 2023Quote: ... To detect sinapoylmalate and intact indole-3-methyl glucosinolate (I3M) contents, an AcclaimTM RSLC120 C18 column (100 mm x 3 mm, 2.2 µm) (ThermoFisher Scientific, MA) was used in conjunction with mobile phases consisting of solvent A (0.1% formic acid (v/v ...
-
bioRxiv - Cell Biology 2021Quote: ... 2X SSC) for 5 min and counter stained with 1 μg/ml DAPI (4’,6-diamidino-2-phenylindole; Life Technologies). Coverslips were mounted in imaging buffer (3.7 μg/μl glucose oxidase and 1U catalase in equilibration buffer ...
-
bioRxiv - Physiology 2019Quote: ... 10 μm thickness muscle cryosections were incubated with 5 μM of 2’,7’-dichlorodihydrofluorescein diacetate (DCFH; Molecular Probes, Eugene) and allowed to dry overnight at room temperature in dark ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: Liver-Chips were stained in the upper channel with 5(6)-Carboxy-2′,7′-dichlorofluorescein diacetate (CDFDA) (Thermo Fisher) to visualize bile canaliculi and MRP2 activity ...
-
bioRxiv - Plant Biology 2021Quote: ... The supernatant was discarded and the pellet was resuspended in 5 mL liquid KNOP supplemented with 2% (w/v) sucrose (#S/8600/60, Fisher) and 100 μM 3’,5’-dimethoxy-4’-hydroxyacetophenone (acetosyringone) (#115540050, Acros Organics, dissolved in dimethyl sulfoxide (DMSO) (#D8418 ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Bruner and Siliciano, 2018), env (Forward: 5’-AGTGGTGCAGAGAGAAAAAAGAGC-3’, Reverse: 5’-GTCTGGCCTGTACCGTCAGC-3’, Probe: 5’/VIC/CCTTGGGTTCTTGGGA/3’/MGB) (Thermo Fisher Scientific) (Bruner et al. ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Palmer et al., 2003) and pol (Forward: 5’-GCACTTTAAATTTTCCCATTAGTCCTA-3’, Reverse: 5’-CAAATTTCTACTAATGCTTTTATTTTTTC-3’, Probe: 5’/NED/AAGCCAGGAATGGATGGCC/3’/MGB) (Thermo Fisher Scientific) (Schmid et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Neuroscience 2021Quote: ... we added a 1 mL of the following mixture to the culture media and incubated the cells at 25°C incubator for 1—3 hours: 5 μM Fura-2 AM (F-1201, Life Technologies), 250 μM probenecid (162-26112 ...
-
bioRxiv - Developmental Biology 2021Quote: ... were: rat anti-E-cadherin (1:500, Thermo Fisher, Cat. No. 13-1900, clone ECCD-2), goat anti-Sox2 (1:150 ...
-
bioRxiv - Immunology 2022Quote: ... and 5 μL 7-AAD (Invitrogen, 00-6993-50). 7-AAD- ...
-
bioRxiv - Immunology 2022Quote: ... and 5 μL 7-AAD (Invitrogen, 00-6993-50). 7-AAD- ...
-
bioRxiv - Immunology 2023Quote: ... 5 μl of 7-AAD (Invitrogen, 00-6993-50) was included for dead cell exclusion.
-
bioRxiv - Immunology 2022Quote: ... targeting SAMHD1 (sense RNA 5’-GCAGAUAAGUGAACGAGAUTT-3’, antisense RNA 5’-AUCUCGUUCACUUAUCUGCAG-3’) or the negative control #1 siRNA using RNAiMAX (ThermoFisher, 13778-075). 24 h after transfection ...
-
bioRxiv - Microbiology 2024Quote: ... was added at a 1:2000 dilutions for 1 h at 37 °C, followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Fisher Scientific) for 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μg/mL 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside (X-Gal) (Thermo Scientific) and 1 mM isopropyl beta-D-thiogalactopyranoside (IPTG ...
-
bioRxiv - Genetics 2019Quote: ... Pools were separated on a 4% agarose E-Gel (Life Technologies) and the 140–160 nt length bands were excised and purified using MiniElute Gel Extraction kit (Qiagen) ...
-
bioRxiv - Biophysics 2023Quote: ... PCR products were visualized on a 4% agarose E-gel (Invitrogen) and gel purified using an Invitrogen gel purification kit (Invitrogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... Nuclei were stained with 5 µg / µl 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) and slides were mounted with FluoromountG (SouthernBiotech).
-
bioRxiv - Genomics 2021Quote: ... Linker oligo sequences were: 5’ – TTCAGACGTGTGCTCTTCCGATCTNNNNNNNNNNCAGGCTACTCCGCTTAAGGGAC-3’ (linker 1, Invitrogen, UK) and 5’-GTCCCTTAAGCGGAGTAGCCTG/3AmMO/-3’ (linker 2 ...
-
bioRxiv - Microbiology 2023Quote: ... HSV-1 Probe FAM-5’-CGGCCCAACATATCGTTGACATGGC-3’-MGBNFQ (Thermo Fisher Scientific). The efficiency of each round of PCR was determined using 10-fold dilutions of Topo TA plasmids (Invitrogen AB ...
-
bioRxiv - Cancer Biology 2022Quote: ... culture medium was replaced with 100 µL full melanoma medium with 4 µM Caspase-3/7 activity dye (CellEvent, Thermo Fisher Scientific). Plates were then imaged on a Celigo Imaging Cytometer (Nexcelom ...
-
bioRxiv - Microbiology 2022Quote: ... to approximately 5 µl and 4 µl were transformed into 100 µl of ElectroMax DH5α-E Competent Cells (Cat# 11319019, Thermo Fisher Scientific). After 30 min of recovery at 37°C in 4 ml of SOC medium ...
-
bioRxiv - Cell Biology 2020Quote: ... SUMO-2/3 (Invitrogen); β-Catenin (BD Transduction Laboratories) ...
-
bioRxiv - Microbiology 2021Quote: ... 2 μL of 10 mM NBD-(linezolid-7-nitrobenz-2-oxa-1,3-diazol-4-yl)-amino-D-alanine (NADA) (Thermo Fisher) was added to each tube and incubated at 37° C ...
-
bioRxiv - Biophysics 2019Quote: ... N’-dimethyl-N-(iodoacetyl)-N’-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)ethylenediamine] (Thermo Fisher Scientific, Inc., Waltham, MA). Y-ATRAM (Table 1 ...
-
bioRxiv - Biochemistry 2021Quote: ... with a 10-fold excess of N,N’-dimethyl-N-(iodoacetyl)-N’-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) ethylenediamine (IANBD-amide, Molecular Probes). After 90 min on ice ...
-
bioRxiv - Neuroscience 2022Quote: Larval fish (4-7 dpf) were mounted in a small drop of 2% low melting point agarose (ThermoFisher Scientific 16520) in the center of the uncoated side of a mirror galvanometer (Thorlabs GVS0111) ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were washed 4-5 times in PBS for 2 hours then incubated for 3-4 hours with secondary antibody (anti-rabbit Alexa Fluor 568; 1:1000; Invitrogen; Cat #A10042) and NeuroTrace Green Fluorescent Nissl Stain (1:2000 ...
-
bioRxiv - Microbiology 2019Quote: ... Primer 2: 5’-GGATGTTCGTCCAGTGAGATTAG-3’) using a 7500 Fast Real-Time PCR System (Applied Biosystems) and accompanying software to analyze qPCR data.
-
bioRxiv - Bioengineering 2022Quote: ... Spheroid viability was evaluated at days 1 and 7 via Calcein AM (Invitrogen, 2 µM) and ethidium homodimer (Invitrogen ...