Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for 6 METHOXY 1 2 3 4 TETRAHYDRO NAPHTHALENE 2 CARBALDEHYDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... and nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific) at 1:2,000 dilution at RT for 5 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... All samples were counterstained in 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen, D1306) for 10 minutes at room-temperature and mounted in ProLong Gold Antifade (Thermo fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... Nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) for 5 min at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... Cell nuclei were labelled using 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI, Invitrogen) and coverslipped using ProLong Gold anti-fade reagent (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... Nuclei were stained with DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (Life Technologies) at a dilution of 1:5000 in 1 X PBS ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were counterstained using 4’ ,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) to visualize the nuclei ...
-
bioRxiv - Microbiology 2019Quote: ... Nuclei were then stained with DAPI (4’,6- diamidino-2-phenylindole, dihydrochloride, ThermoFisher, 62247 ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were counterstained using 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) to visualize the nuclei and finally washed with PBS.
-
bioRxiv - Cancer Biology 2021Quote: ... The nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI, Molecular Probes) at 1 μg/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... Nuclei were staining with DAPI (4′,6-diamidino-2-phnylindole) from Molecular Probes. Confocal images were acquired using a Leica Sp8 confocal microscope and processed using Imaris image analysis software (version 9.3.1).
-
bioRxiv - Cancer Biology 2022Quote: ... sulfosuccinimidyl 6-(4’-azido-2’-nitrophenylamino)hexanoate (sulfo-SANPAH; 22589, Thermo Fisher Scientific), 3-(Acryloyloxy)propyltrimethoxysilane (L16400 ...
-
bioRxiv - Immunology 2022Quote: ... Nuclei were stained with 4′-6-diamidino-2-phenylindole (DAPI) dihydrochloride (Life Technologies), and lung sections were mounted on glass microscopy slides using fluorescence mounting medium (Dako) ...
-
bioRxiv - Cancer Biology 2020Quote: ... stained with 4’,6-diamidino-2-phenylindole (DAPI, 0.1 μg/mL; #D1306, Invitrogen) and mounted with Prolong Gold antifade medium (#P10144 ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were counterstained using 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) to visualize the nuclei ...
-
bioRxiv - Neuroscience 2022Quote: ... incubated with 4′,6-diamidino-2-pheny-lindoldihydrochloride (DAPI, Thermo Fisher Scientific #D3571) diluted in DPBS for 10 minutes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Nuclear stain: 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI; 2ng/ml; Molecular Probes). Sections were cover-slipped using ProLong Gold anti-fade reagent (InVitrogen ...
-
bioRxiv - Bioengineering 2019Quote: ... Nuclear stain: 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI; 2ng/ml; Molecular Probes). Sections were cover-slipped using ProLong Gold anti-fade reagent (InVitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... Sections were counterstained with DAPI (4′,6-diamidino-2-phenylindole dihydrochloride; Molecular Probes). Pictures were taken using a TCS SP5 Inverted confocal (Leica ...
-
bioRxiv - Genetics 2021Quote: ... Tissue slides were also stained with DAPI (4′,6-diamidino-2-phenylindole, Invitrogen) to visualize the total number of nucleated myocardial cells within each section ...
-
bioRxiv - Neuroscience 2021Quote: ... Brain slices were incubated in 4’,6-diamidino-2-phenylindole (DAPI, Acros Organics–Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were counterstained using 4’,6-Diamidino-2-Phenylindole (DAPI – Life Technologies, D1306) diluted in PBS before being mounted on microscope slides with ProLong Gold Antifade Mountant (Life Technologies ...
-
bioRxiv - Immunology 2019Quote: ... the cells were stained with 4’,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher), fixed with 4% paraformaldehyde in PBS and incubated for 10 min at RT ...
-
bioRxiv - Bioengineering 2019Quote: ... Primary antibodies together with 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) diluted in 2% BSA in PBS were incubated overnight at 4°C ...
-
bioRxiv - Genomics 2021Quote: ... the DNA was counterstained with DAPI (4′,6-diamidino-2-phenylindole, ThermoFisher Scientific) diluted 1:10,000 with PBST ...
-
bioRxiv - Cell Biology 2021Quote: ... Fluoromount-G mounting medium with 4′,6-diamidino-2-phenylindole (Invitrogen, Waltham, MA) was used to mount the samples.
-
bioRxiv - Developmental Biology 2022Quote: ... briefly washed with PBST and DAPI (4’,6-diamidino-2-phenylindole, Thermo Scientific) was added to PBST at a 1 in 1000 dilution ...
-
bioRxiv - Microbiology 2022Quote: ... dried and stained with 10 μM 4’,6-diamino-2- phenylindole (DAPI) (Invitrogen). After another round of PBS wash ...
-
bioRxiv - Microbiology 2023Quote: ... Nuclei were stained with DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (Life Technologies) at a dilution of 1:5000 in 1X PBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI; FluoroPure grade; D21490, Thermo Scientific) were used to fix and stain the nuclei ...
-
bioRxiv - Genomics 2023Quote: ... cells were incubated with 4’,6-diamidino-2-phenylindole (DAPI Thermo Fisher Scientific) and AlexaFluor 555 anti-mouse (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were mounted with ProLong and 4’,6’-diamidino-2-phenylindole (DAPI) (Invitrogen) and imaged using a Zeiss Imager M2 Plus wide field fluorescence microscope ...
-
bioRxiv - Developmental Biology 2023Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenyl-indole (DAPI, Life Technologies) and sections were examined with a confocal laser scanning microscope (Carl Zeiss Inc ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sections were counterstained with DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride; Invitrogen; D1306) and cover-slipped with Fluoromount-G (Southern Biotech ...
-
bioRxiv - Immunology 2023Quote: ... cells were incubated with 4’,6-diamidino-2-phenylindole (DAPI, 62247, ThermoFisher Scientific) for 2 minutes at 1:2000 dilution in 1X PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... and 300 µM of 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) was used to stain cell nuclei ...
-
bioRxiv - Genetics 2023Quote: ... For each 6-well added 2 mL of 4% PFA (cat#28906 Thermofisher) in PBS (cat#10010-023 Gibco ...
-
bioRxiv - Cancer Biology 2023Quote: ... Nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific). The preparations were analyzed under a confocal microscope Zeiss 510 LSM META and Zeiss 780-NLO (Carl Zeiss Microscopy ...
-
bioRxiv - Molecular Biology 2023Quote: ... Nuclei were stained with DAPI (4′,6-diamidino-2-phenylindole) (Thermo Fisher Scientific). Finally ...
-
bioRxiv - Microbiology 2023Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI) (ThermoFisher Scientific, 62248). The percentage of infected cells at each time point was quantified using ImageJ software.
-
bioRxiv - Microbiology 2023Quote: ... fixed cells were stained with 4’,6-diamidino-2-phenylindole (DAPI, Thermo Scientific) diluted 1:1000 in phosphate-buffered Saline (PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... nuclei were stained with DAPI (4’,6-diamino- 2-phenylindole, dihydrochloride, Thermofisher, #D3571) solution (0.5 mg/ml) ...
-
bioRxiv - Cell Biology 2024Quote: ... Cell nuclei were labeled with dapi (4 ’, 6-diamidino-2-phenylindole, Invitrogen, P36931). Images were obtained in the Zeiss LSM 800 Confocal Optical Microscope at Centro de Micro y Nanoscopía de Córdoba (CEMINCO-CONICET-UNC ...
-
bioRxiv - Developmental Biology 2023Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2024Quote: ... All sections were counterstained with 4’,6’-diamidino-2-phenylindole (DAPI) (Thermo Fisher) before mounting.
-
bioRxiv - Neuroscience 2024Quote: ... and 300 μM of 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) was used to stain cell nuclei.
-
bioRxiv - Microbiology 2022Quote: ... and L plasmids at a ratio of 4:2:2:2:1 using Lipofectamine 2000 (ThermoFisher Scientific). Cells were transfected in 6 well plates and subsequently transferred to T25 flasks with HEp2 cells until cytopathic effect (CPE ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Cell Biology 2020Quote: ... SUMO-2/3 (Invitrogen); β-Catenin (BD Transduction Laboratories) ...
-
bioRxiv - Neuroscience 2019Quote: ... Cells were passaged 1:2-1:6 every 2-5 days by being rinsed once with DPBS (Gibco) and dissociated using 0.5 mM EDTA (75 μl/cm2 ...
-
bioRxiv - Bioengineering 2021Quote: ... 1-2 drops of CytoSeal (Thermofisher, 8312-4) were placed on each before mounting a coverslip ...