Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for 6 Hydroxy 1H indole 3 carboxylic acid methyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... The resulting pellet was used for labelling with Alexa Fluor 647 NHS ester (succinimidyl ester, Invitrogen) in 100 mM sodium bicarbonate buffer pH 8.3 ...
-
bioRxiv - Physiology 2020Quote: ... Slides were rinsed in PBS 3×5min and then incubated for 1h at room temperature in goat anti-rabbit AF647 (1/250, 21245, Life Technologies) or donkey anti-goat AF647 (1/500 ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were then washed 3× with PBS and incubated for 1h with the corresponding Alexa Fluor secondary antibodies (Thermo Fisher Scientific) at 1:1000 dilution (in 3% BSA ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Synthetic Biology 2020Quote: Cell growth and multiplication was assessed by Fluorescence Assorted Cell Sorting and fluorescence microscopy with 6-Carboxyfluorescein diacetate succinimidyl ester (CFDA-SE, Life Technologies, USA) as a probe ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Ag83 parasite growth and multiplication were assessed by Fluorescence Assorted Cell Sorting and fluorescence microscopy with 6-Carboxyfluorescein diacetate succinimidyl ester (CFDA-SE, Life Technologies, USA) as a probe ...
-
bioRxiv - Cell Biology 2022Quote: ... 2’,7’-Bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM) was purchased from Molecular Probes (Invitrogen, Carlsbad, CA, USA). Fluorescein isothiocyanate (FITC)- and tetramethylrhodamine (TRITC)-conjugated goat anti-mouse and rabbit IgG antibodies were purchased from Jackson ImmunoResearch (West Grove ...
-
bioRxiv - Biophysics 2022Quote: ... EVs were stained with 5-(and-6)-Carboxyfluorescein diacetate succinimidyl ester (CFDA-SE, hereinafter referred as CFSE) (Thermo Fisher, Catalog No. C1157) and separated as described previously [10] ...
-
bioRxiv - Cell Biology 2022Quote: ... SE (6-((acryloyl)amino)hexanoic acid)-labelled fibronectin (A20770, ThermoFisher Scientific; FC010, EMD Millipore), and polymerized on activated glass coverslips for 1 hr at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... ethyl ester (TMRE) (Thermo Fisher #T669) at a final concentration of 0.3 μg/mL ...
-
bioRxiv - Cell Biology 2020Quote: ... or Alexa647 NHS ester (ThermoFisher, A20006) for 15 minutes at RT ...
-
bioRxiv - Immunology 2021Quote: ... acetyl ester (CM-H2DCFDA) probe (Invitrogen) for 45 minutes at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... carboxyfluorescein succinimidyl ester (Thermo Fisher Scientific) at 37°C for 20 minutes ...
-
bioRxiv - Cell Biology 2022Quote: BODIPY TMR-X NHS Ester (ThermoFisher) was used to fluorescently label LRRK2RCKW and LRRK1RCKW ...
-
bioRxiv - Cell Biology 2019Quote: ... or rhodamine NHS ester (ThermoFisher, 46406). NHS esters and probes were incubated overnight in 0.1M sodium bicarbonate solution (pH 8.0 ...
-
bioRxiv - Cell Biology 2020Quote: ... succinimidyl ester (AcX, Thermo Fisher Scientific) in PBS overnight ...
-
bioRxiv - Cell Biology 2020Quote: ... succinyl ester (Molecular Probes, Eugene, OR) for 1 hour at room temperature in the dark ...
-
bioRxiv - Cell Biology 2022Quote: ... Fluorescent ester dyes (green: Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2019Quote: ... succinimidyl ester (CFDA-SE; Molecular Probes) for analysis of proliferation was performed following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... succinimidyl ester) (AcX) (A20770, ThermoFisher Scientific) was re-suspended in anhydrous DMSO with a final concentration of 10 mg/ml ...
-
bioRxiv - Immunology 2020Quote: Indo-1 AM (acetoxymethyl ester; Invitrogen) was added to 3 × 106 leukemia/lymphoma cells in 500 μl Hank’s Balanced Salt Solution (HBSS ...
-
bioRxiv - Cancer Biology 2020Quote: ... Carboxyfluorescein-succinimidyl ester (CFSE, Life Technologies) was used to track cell proliferation ...
-
bioRxiv - Immunology 2021Quote: ... Atto 488 NHS ester ((ThermoFisher Scientific), Collagenase Type I (ThermoFisher Scientific) ...
-
bioRxiv - Immunology 2022Quote: ... AlexaFluor 647 NHS esters (Thermo Fisher) in Sodium Carbonate buffer ...
-
bioRxiv - Microbiology 2022Quote: ... succinimidyl ester (Invitrogen, Waltham, MA, USA). Labelled macrophages and spores were co-incubated at a multiplicity of infection (MOI ...
-
bioRxiv - Synthetic Biology 2022Quote: ... NHS-ester conjugated Atto488 (Thermo Fisher) or Cy5 (GE Healthcare ...
-
bioRxiv - Synthetic Biology 2023Quote: ... DyLight™ 405 NHS ester (ThermoFisher), FITC NHS ester (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2023Quote: ... AM ester (Thermo Fisher, USA, C3018), 6,8 µg/ml in E3 medium ...
-
bioRxiv - Immunology 2023Quote: ... or Alexa Fluor NHS Ester (ThermoFisher) (with primary stain) ...
-
bioRxiv - Biochemistry 2022Quote: ... Using Alexa568-NHS ester (Invitrogen, A20003) yielded 36-40% labeling efficiency ...
-
bioRxiv - Biochemistry 2023Quote: ... using biotin succinimidyl ester (Life Technologies).
-
bioRxiv - Physiology 2024Quote: ... Ethyl Ester (TMRE; ThermoFisher Scientific: T669), and 1μM of MitoTracker Green (InvitrogenTM ...
-
Model-based inference of a plant-specific dual role for HOPS in regulating guard cell vacuole fusionbioRxiv - Systems Biology 2023Quote: ... Acetoxymethyl Ester (BCECF, Fisher Scientific B1170), 50 mM abscisic acid (ABA ...
-
bioRxiv - Immunology 2023Quote: ... Alexa Fluor 488 NHS Ester (Invitrogen) was used to fluorescently label loose collagen gels as described below ...
-
bioRxiv - Microbiology 2023Quote: Texas Red-X succinimidyl ester (Invitrogen) was conjugated to tobramycin as previously described (93 ...
-
bioRxiv - Microbiology 2024Quote: ... Acetoxymethyl Ester (BCECF-AM) (Molecular Probes) was added to mid-log phase cells in BCECF LB (LB ...
-
bioRxiv - Cell Biology 2024Quote: ... NHS-ester 405 (Thermofisher, 1:250). The gels were imaged using a Zeiss LSM 980 microscope with Airyscan 2 ...
-
bioRxiv - Cell Biology 2024Quote: ... Succinimidyl ester (Thermo Fisher Scientific, A20006), all used at 1:500 ...
-
bioRxiv - Physiology 2020Quote: Acid extracted rat tail Type I Collagen (3 mg/mL; Thermo Fisher) was maintained at 4°C until polymerization ...
-
bioRxiv - Immunology 2023Quote: ... post-dose 3 and 6-months post-dose 3 using mouse anti-human IgG1 biotin (Thermo Fisher Scientific) and mouse anti-human IgG4 biotin (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... for 3 min and incubated in 1% phosphomolybdic acid then acetic acid solution (A38C-212; Thermo Fisher Scientific, Waltham, MA) for 5 min and 3 min ...
-
bioRxiv - Microbiology 2020Quote: IgG labeling was performed by incubation of antibodies with Alexa Fluor647 NHS Ester (Succinimidyl Ester; ThermoFisher Scientific). In detail ...
-
bioRxiv - Biophysics 2024Quote: ... cat# 16884-H08H) were labelled with Alexa Fluor™ 488 NHS Ester (Succinimidyl Ester, ThermoFisher, cat# A20000) and Alexa Fluor™ 647 NHS Ester (Succinimidyl Ester ...
-
bioRxiv - Microbiology 2024Quote: ... and the virus was incubated with 25 μg of Alexa Fluor 488 NHS Ester (succinimidyl ester; Invitrogen) for 1 hour at 25°C ...
-
bioRxiv - Cell Biology 2023Quote: ... All chemical inhibitors were diluted in DMSO and were: 3-O-Methyl-Sphingomyelin (SMPD3 inhibitor, Enzo Life technologies, BML-SL225-0005), FAM14 inhibitor (FAK inhibitor ...
-
bioRxiv - Microbiology 2021Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). SARS-CoV-2 standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g.
-
bioRxiv - Cancer Biology 2021Quote: ... 10 ng/ml IL-6 and 10 ng/ml IL-3 (Gibco). Inpp4b+/+ and Inpp4b-/- LSK were each retrovirally transduced with pMSCV-MLL-AF9-IRES-mVenus ...
-
bioRxiv - Microbiology 2023Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). SARS-CoV-2 standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Cells were washed then incubated in 8 μM of the ROS sensitive probe 5-(and-6)-chloromethyl-2′,7′-dichlorodihydrofluorescein diacetate acetyl ester (CM-H2DCFDA) (Molecular Probes, Eugene Oregon), for 45 minutes ...
-
bioRxiv - Plant Biology 2022Quote: ... Each sample was incubated with 50 µm of 2’,7’-Bis-(2- carboxyethyl)-5-(6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM; Molecular Probes, Eugene, OR) at 28°C ...