Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for 5 1 3 benzothiazol 2 ylamino pentanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: All samples were diluted 1/200 in 2% trace metal grade nitric acid (Thermo Fisher Scientific) and analyzed by an Agilent 7800 ICP-MS for all REE concentrations (m/z ...
-
bioRxiv - Cell Biology 2022Quote: ... 25 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES; Thermo Fisher Scientific, Cat. no. 15630-080,) and 1% penicillinstreptomycin (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2022Quote: ... 0.1 M 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffer (pH = 8.5) (ThermoFisher Scientific, Waltham, MA), 4-benzoylbenzyl-trimethylammonium chloride (PLPP ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1% nonessential amino acids (11140050) and 0.1 mM 2-mercaptoethanol (31350-010) (all Thermo Fisher Scientific), 12 ng/mL LIF (104278 ...
-
bioRxiv - Genomics 2024Quote: ... and lacking sodium pyruvate and HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) (McCoy‘s 5A, Gibco 16600082), supplemented with 10% fetal bovine serum (Gibco ...
-
bioRxiv - Immunology 2021Quote: ... + 2 mM Glutamax + 1x non-essential amino acids (Gibco) + 57µM β-Mercaptoethanol (Sigma ...
-
bioRxiv - Bioengineering 2022Quote: ... 5,5’-dithiobis-(2-nitrobenzoic acid) (Ellman’s reagent, Life Technologies), pyridine (Fisher) ...
-
bioRxiv - Microbiology 2020Quote: ... 10 mM 5,5’-dithiobis (2-nitrobenzoic acid) (Thermo Scientific) prepared in 40 mM potassium phosphate buffer (pH 7.5 ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 mL of non-essential amino acids (NEAA) (Gibco), and 400 uL of beta-mercaptoethanol (Life Technologies).
-
bioRxiv - Microbiology 2024Quote: ... 2 mM ethylenediaminetetraacetic acid (EDTA, Fisher Scientific; cat# AM9260G), and 0.5% (v/v ...
-
bioRxiv - Immunology 2020Quote: ... 2-mercaptoethanol (5 µM, Gibco) and 150 IU/ml human rIL-2 and 50ng/ml rIL-15) ...
-
bioRxiv - Cell Biology 2024Quote: ... Mouse IgG1 anti-alpha Tubulin Clone B-5-1-2 (1:500, ThermoFisher 32-2500), Rabbit anti-Myc polyclonal (1:500 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fgfrb_fwd 5’-AAACGCGAAAAGACCCTGATAGC-3’ and Fgfrb_rev 5’-GGACAGCGGGGACGTCAG-3’ Antisense probe was synthesized by in vitro transcription (MEGAScript Kit; Ambion) driven by T7 RNA polymerase with DIG incorporation (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... STAG3: 5’-CUGGAUUAACAUGCCUACU(dTdT)-3’ WAPL: 5’- GUCCUUGAAGAUAUACCAA(dTdT)-3’ Oligonucleotides were transfected using Lipofectamine RNAiMAX (Thermo Fisher; 13778150) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... N gene reverse primer (5’-GAGGAACGAGAAGAGGCTTG-3’) and probe (5’-FAM-ACTTCCTCAAGGAACAACATTGCCA-QSY-3’) using Taqman mastermix (Thermo Fisher). The thermal cycling steps were ...
-
bioRxiv - Immunology 2022Quote: ... The number of DCV copies in these samples was quantified using DCV specific primers (DCV_Forward: 5′ AATAAATCATAAGCCACTGTGATTGATACAACAGAC 3′, DCV_Reverse: 5′ AATAAATCATAAGAAGCACGATACTTCTTCCAAACC 3′) and Fast SYBR green (Applied Biosystems) based qRT-PCR (Applied Biosystems StepOne Plus) ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Cell Biology 2023Quote: ... and reference 18S ribosomal RNA gene (Forward primer: 5′-TAGAGGGACAAGTGGCGTTC-3′, Reverse primer: 5′-CGCTGAGCCAGTCAGTGT-3′, Invitrogen custom primers) was independently amplified using thermocycling conditions as described in 58 ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... siPARP7 (sense strand 5’-AAUACUCUCAUCGAACGGAAGTT-3’) or si-p21 (sense strand 5-AACAUACUGGCCUGGACUG-3’) using Lipofectamine RNAiMAX (Invitrogen 56532). After 24 hrs of transfection ...
-
bioRxiv - Genomics 2021Quote: ... and then blocked for 1 hour with 1 ml of blocking buffer (wash buffer containing 3% fatty acid free BSA (Thermo Fisher, 126609)) ...
-
bioRxiv - Molecular Biology 2021Quote: 0.63 mmole (1 equivalent) of the nucleoside-5’-monophosphate free acid (Santa Cruz Biotechnology or ACROS Organics) and 5 equivalents of 2-aminoimidazole hydrochloride (Combi-Blocks ...
-
bioRxiv - Synthetic Biology 2020Quote: 0.63 mmole (1 equivalent) of the nucleoside-5’-monophosphate free acid (Santa Cruz Biotechnology or ACROS Organics) and 5 equivalents of 2-aminoimidazole hydrochloride (Combi-Blocks ...
-
bioRxiv - Bioengineering 2021Quote: ... 5 × 10−5 M 2-mercaptoethanol (Gibco, 31350-010), 1X Minimal Essential Medium (MEM ...
-
bioRxiv - Bioengineering 2021Quote: ... 5 × 10-5 M 2-mercaptoethanol (Gibco, 31350-010), 1X Minimal Essential Medium (MEM ...
-
bioRxiv - Biochemistry 2020Quote: ... strains were negatively selected against the URA3 marker gene using 1 mg/mL of 5-Fluoroorotic Acid (5-FOA) (Fisher Scientific, F10501-5.0) in SD-plates ...
-
bioRxiv - Cell Biology 2020Quote: Fibroblasts were plated in 96-well plates (10,000 fibroblasts/well) for 3 days in 2% FBS in DMEM supplemented with ascorbic acid (50 μg/mL) (Fisher Scientific, Waltham, MA, USA). Fibroblasts and matrix were then fixed and immunostained as detailed above ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 μL of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, concentration 5 mg/mL, Invitrogen, cat. M6494) in PBS was added to each well containing culture medium and incubated for 2.5 h at 37 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... The culture medium was changed every 2 to 3 days and the cells were split every 5 to 7 days using 0.25% Trypsin-EDTA (Gibco), up to 20 times ...
-
bioRxiv - Molecular Biology 2022Quote: Fresh tissue samples were washed 2–3 times in PBS and incubated in 5 U/ml dispase (ThermoFisher Scientific) supplemented with antibiotics (penicillin 50U/I and streptomycin 50 mg/ml ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... were maintained in a water jacketed 5 % CO2 incubator and passaged every 2-3 days using trypsin/EDTA (Gibco). 1E6 cells were seeded into 6 well plates ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were passaged 1:10 every 2–3 days with 1× trypsin-EDTA 0.25% (Gibco 25200-056).
-
bioRxiv - Microbiology 2023Quote: Cell pellets were acid digested with 2 mL of Optima grade nitric acid (ThermoFisher, Waltham, MA) and 500 μL hydrogen peroxide (Sigma ...
-
bioRxiv - Microbiology 2024Quote: Cell pellets were acid digested with 2 mL of Optima grade nitric acid (ThermoFisher, Waltham, MA) and 500 μL hydrogen peroxide (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μM of 20-base model RNA (5’-AAUCUAUAAUAGCAUUAUCC-3’; ThermoFisher Scientific) was treated with 300 nM of purified recombinant SARS-Cov2 NSP13 with an N-terminal His-tag (Cayman Chemicals #30589 ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 mM 3,4-Dihydroxybenzoic acid (Fisher Scientific, Cat. No. AC114891000), 50 nM protocatechuate dioxygenase (Millipore Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mL MEM Non-essential Amino Acids (Thermo Fisher Scientific), 1 mL 200 mM ascorbic acid (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... The nucleic acid stain Hoechst 33342 (5 μM, Life Technologies) was included in the media to facilitate visualization of the nuclei ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 ml 100x non-essential amino acids (Gibco #11140-35), 1 mL 500x β-mercaptoethanol (5mM ...
-
bioRxiv - Immunology 2024Quote: ... 5 mM MEM 140 Non-Essential Amino Acids (NEAA; Gibco), 2mM Glutamax (Gibco) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1% nonessential amino acids (Invitrogen), 0.1mM β-mercaptoethanol (Sigma) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1% nonessential amino acids (Invitrogen), 1% Sodium-pyruvate (BI 03-042-1B) ...
-
bioRxiv - Biochemistry 2020Quote: ... span)/1‰ formic acid (Fisher Scientific), phase B ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% nonessential amino acids (Gibco) and supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2021Quote: ... 1% nonessential amino acids (Invitrogen), 100 μg/mL of streptomycin (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... 1% nonessential amino acids (Gibco), 2% tryptose phosphate broth (Sigma) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1% nonessential amino acids (Gibco), 2 mM L-glutamine and 1,000 U/mL leukaemia inhibitory factor (LIF ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1× nonessential amino acids (Gibco), 1× sodium pyruvate (Gibco ...
-
bioRxiv - Biochemistry 2020Quote: ... Spain)/1‰ formic acid (Fisher Scientific), phase B ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1% nonessential amino acids (Gibco), 1% penicillin/streptomycin (Gibco) ...