Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for 4 4 Fluoro 2 hydroxyphenyl methyl 2 6 bis 1 methylethyl 5 propyl 3 pyridinemethanol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... slides were counterstained for 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, R37606) for 5-10 mins before mounting ...
-
bioRxiv - Neuroscience 2024Quote: ... incubated with DAPI (4′,6- diamidino-2-phenylindole, Invitrogen, catalogue number D1306) (0.5µg/ml in PBS ...
-
bioRxiv - Developmental Biology 2024Quote: ... Sections were counterstained with 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, D1306) and coverslipped in Aqua-Poly/Mount (Polysciences #18606).
-
bioRxiv - Biophysics 2024Quote: ... The nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen). Fluorescent images were captured at seven fields of view using an inverted fluorescent microscope (Optics11 Life ...
-
bioRxiv - Cancer Biology 2024Quote: ... added with DAPI (4′,6-diamidino-2-phenylindole, Life Technologies, Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... cells were incubated in glucose-free media containing 5 μg/ml 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Thermo Fisher) and 2.5% FBS at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Microbiology 2024Quote: ... 1% 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES; Gibco) and maintained at 28°C in the absence of CO2 ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNA#4: 5’-AUAGCGUUUCUUCUAACUGGGCAGC-3’ (Invitrogen). siRNAs #2 and #4 significantly decreased the mRNA levels to the greatest extent and both had the same mitotic phenotypes ...
-
Glycogen Synthase Kinase 3 regulates the genesis of the rare displaced ganglion cell retinal subtypebioRxiv - Neuroscience 2021Quote: ... Sections were counterstained with 1:1000 4′,6-diamidino-2-phenylindole (DAPI) (1 mg/mL, Thermo Scientific).
-
bioRxiv - Bioengineering 2021Quote: ... 1-2 drops of CytoSeal (Thermofisher, 8312-4) were placed on each before mounting a coverslip ...
-
bioRxiv - Microbiology 2020Quote: ... PobA activity was inhibited with methyl 4-hydroxy-3-iodobenzoate (Fisher Scientific) at a saturating concentration (0.48 mM) ...
-
bioRxiv - Neuroscience 2021Quote: ... the Ca+2 indicator Fluo-4-AM (Molecular Probes, Eugene, OR; 2–5 µl of 2 mM dye) were dropped over S1 cortex ...
-
bioRxiv - Biophysics 2023Quote: ... Cell nuclei were stained with 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng/ml; Molecular Probes). Stained sections were imaged using epifluorescence and deconvolution epifluorescence microscopy on an Olympus IX83 ...
-
bioRxiv - Neuroscience 2024Quote: ... Cell nuclei were stained with 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng/mL; Molecular Probes) for 15 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were marked with 2,3×10−3 μg/μL 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Thermo Fisher Scientific) for 10 minutes at room temperature in the dark ...
-
bioRxiv - Biochemistry 2024Quote: ... and 10% 2-mercaptoethanol and run on NuPAGE 4-15% bis-tris gels (Thermo Fisher). Proteins were transferred to nitrocellulose membranes ...
-
bioRxiv - Bioengineering 2024Quote: Coronal sections of healthy murine brain were prepared and stained as previously described101 either using 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng mL−1; Molecular Probes) to stain cell nuclei or primary antibodies for rabbit anti-NeuN (1:1000) ...
-
bioRxiv - Genetics 2020Quote: ... boiled in reducing sample buffer for 5 min and resolved on 4–12% Bis-Tris Bolt gels and transferred using an iBlot 2 (Thermo Fisher). Blots were blocked in 2.5% milk in 1% TBS-Tween before staining with antibodies (Table S5) ...
-
bioRxiv - Neuroscience 2021Quote: ... slices were incubated with 4’,6-diaminodino-2-phenylindole (DAPI, Life Technologies D-21490, 1:2000) for 15 min ...
-
bioRxiv - Neuroscience 2020Quote: ... The nuclear dye 4’,6-diamidino-2-phenylindole (DAPI) at 1 l ng/ml (Molecular Probes) was added to visualise all cells ...
-
bioRxiv - Physiology 2020Quote: ... Cell nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI; 1:10,000; ThermoFisher, Table S13). Confocal images were acquired using an inverted laser scanning confocal microscope (Nikon Eclipse C1) ...
-
bioRxiv - Immunology 2021Quote: ... Nuclei were counterstained with 1/2500 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, ThermoFisher Scientific, USA). The cover slips were fixed in fluorescence mounting medium (Fluoromount-G ...
-
bioRxiv - Immunology 2021Quote: ... Nuclei were counterstained with 1/2500 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, ThermoFisher Scientific, USA). The cover slips were fixed in fluorescence mounting medium (Fluoromount-G ...
-
bioRxiv - Immunology 2021Quote: ... Chamberslides were then incubated in 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI) (1:5,000, ThermoFisher Scientific) in 1x PBS for 5 min ...
-
bioRxiv - Immunology 2020Quote: ... cell nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen, Karlsruhe, Germany, 1:100) for 30 min at RT ...
-
bioRxiv - Immunology 2023Quote: ... Slides were washed and stained with 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, D3571, 1:4000) in PBS for 10 min at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 4′6-diamidino-2-phenylindole (DAPI, nuclei staining, 1:10000; Cat. no. D1306, Life Technologies) diluted in PBS for 30 min at RT ...
-
bioRxiv - Cancer Biology 2022Quote: ... Slides then were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) or with YOYO-1 (ThermoFisher). When HPV probe signal co-localized with YOYO-1 signal detecting DNA at 63x magnification ...
-
bioRxiv - Bioengineering 2022Quote: ... counterstained with 1 μg/mL of 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific, #D1306) for 30 minutes ...
-
bioRxiv - Bioengineering 2022Quote: ... 4-Chlorobenzenesulfonate Salt (DID) and 4′,6-diamidino-2-phenylindole (DAPI) were purchased from Invitrogen (Carlsbad, CA, USA). Ammonium bicarbonate ...
-
bioRxiv - Developmental Biology 2023Quote: ... ATs and TTs were fixed in 4% PFA and stained with 4′,6- diamidino-2-phenylindole (DAPI) (Invitrogen) to identify cell nuclei ...
-
bioRxiv - Bioengineering 2023Quote: ... The cells were washed 4 times with PBST and counterstained with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) at 1:1000 dilution ...
-
bioRxiv - Immunology 2024Quote: ... Cell concentrations were assessed by acquiring 30 μL of resuspended cells diluted 1:5 in PBS-4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific) without any prior washing steps ...
-
bioRxiv - Cell Biology 2022Quote: ... 2’,7’-Bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM) was purchased from Molecular Probes (Invitrogen, Carlsbad, CA, USA). Fluorescein isothiocyanate (FITC)- and tetramethylrhodamine (TRITC)-conjugated goat anti-mouse and rabbit IgG antibodies were purchased from Jackson ImmunoResearch (West Grove ...
-
bioRxiv - Molecular Biology 2021Quote: ... Nuclei were detected by 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, Carlsbad, CA).
-
bioRxiv - Molecular Biology 2020Quote: ... and nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific) at 1:2,000 dilution at RT for 5 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... All samples were counterstained in 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen, D1306) for 10 minutes at room-temperature and mounted in ProLong Gold Antifade (Thermo fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... Cell nuclei were labelled using 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI, Invitrogen) and coverslipped using ProLong Gold anti-fade reagent (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... Nuclei were stained with DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (Life Technologies) at a dilution of 1:5000 in 1 X PBS ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were counterstained using 4’ ,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) to visualize the nuclei ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were counterstained using 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) to visualize the nuclei and finally washed with PBS.
-
bioRxiv - Cancer Biology 2021Quote: ... The nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI, Molecular Probes) at 1 μg/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... Nuclei were staining with DAPI (4′,6-diamidino-2-phnylindole) from Molecular Probes. Confocal images were acquired using a Leica Sp8 confocal microscope and processed using Imaris image analysis software (version 9.3.1).
-
bioRxiv - Cancer Biology 2022Quote: ... sulfosuccinimidyl 6-(4’-azido-2’-nitrophenylamino)hexanoate (sulfo-SANPAH; 22589, Thermo Fisher Scientific), 3-(Acryloyloxy)propyltrimethoxysilane (L16400 ...
-
bioRxiv - Immunology 2022Quote: ... Nuclei were stained with 4′-6-diamidino-2-phenylindole (DAPI) dihydrochloride (Life Technologies), and lung sections were mounted on glass microscopy slides using fluorescence mounting medium (Dako) ...
-
bioRxiv - Cancer Biology 2020Quote: ... stained with 4’,6-diamidino-2-phenylindole (DAPI, 0.1 μg/mL; #D1306, Invitrogen) and mounted with Prolong Gold antifade medium (#P10144 ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were counterstained using 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) to visualize the nuclei ...
-
bioRxiv - Neuroscience 2022Quote: ... incubated with 4′,6-diamidino-2-pheny-lindoldihydrochloride (DAPI, Thermo Fisher Scientific #D3571) diluted in DPBS for 10 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... Sections were counterstained with DAPI (4′,6-diamidino-2-phenylindole dihydrochloride; Molecular Probes). Pictures were taken using a TCS SP5 Inverted confocal (Leica ...