Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for 3 Iodo 2 6 dimethyl benzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... at a ratio of 1:1.5:1.75:2 (FAM155A-3×FLAG:NALCN-1077-3×HA-GFP:UNC79-3×FLAG:UNC80-3×FLAG) using Lipofectamine 3000 (Thermo Fisher Scientific) and incubated for 40-48 hours ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Neuroscience 2022Quote: ... 2 x10^6 in 6 cm dishes or 4 x10^6 in 10 cm dishes (Nunc Edge plates, Thermo Fisher Scientific) in conditioned NB or NB-Plus ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 x10^6 in 6 cm dishes or 4 x10^6 in 10 cm dishes (Nunc Edge plates, Thermo Fisher Scientific) in conditioned NB or NB-Plus ...
-
bioRxiv - Genomics 2023Quote: ... and 10 mM HEPES (N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid, Gibco 15630080), and incubated at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... 2-3 ml RBC Lysing Buffer (Invitrogen) was added to the pellet containing splenocytes and incubated at room temperature for 5-7 min ...
-
bioRxiv - Microbiology 2020Quote: ... and IFNλ−2/3 (Thermo Scientific Mm04204156_gH) and results were normalized to GAPDH (Mm.PT.39a.1 ...
-
bioRxiv - Neuroscience 2021Quote: ... neurons were anchored with succinimidyl ester of 6-((Acryloyl)amino) hexanoic acid (AcX) (Thermofisher) in PBS (0.1mg/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... SE (6-((acryloyl)amino)hexanoic acid)-labelled fibronectin (A20770, ThermoFisher Scientific; FC010, EMD Millipore), and polymerized on activated glass coverslips for 1 hr at room temperature ...
-
bioRxiv - Physiology 2024Quote: ... 6-OHDA was prepared in 0.1% ascorbic acid (Thermo Scientific™, Waltham, MA, USA) and 0.9% sterile NaCl (referred to as saline ...
-
bioRxiv - Physiology 2020Quote: Acid extracted rat tail Type I Collagen (3 mg/mL; Thermo Fisher) was maintained at 4°C until polymerization ...
-
bioRxiv - Biochemistry 2024Quote: ... Auxin (Indole-3-acetic acid) and Doxycycline were sourced from Thermo Fisher Scientific (United States) ...
-
bioRxiv - Immunology 2020Quote: ... Fluorescent dyes including 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen, D21490, 2 μg/mL), wheat germ agglutinin (WGA ...
-
Immunoresolvents Support Skeletal Myofiber Regeneration via Actions on Myeloid and Muscle Stem CellsbioRxiv - Immunology 2020Quote: ... Fluorescent dyes including 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen, D21490, 2 μg/mL), wheat germ agglutinin (WGA ...
-
bioRxiv - Immunology 2023Quote: ... post-dose 3 and 6-months post-dose 3 using mouse anti-human IgG1 biotin (Thermo Fisher Scientific) and mouse anti-human IgG4 biotin (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... Dimethyl pimelimidate dihydrochloride (DMP, Thermo Fisher cat 21667), Tween-20 (Sigma #P1379-100ML) ...
-
bioRxiv - Microbiology 2023Quote: ... DMSO (Dimethyl Sulfoxide, #BP231) was from Fisher Scientific. MetO (L-methionine sulfoxide ...
-
bioRxiv - Neuroscience 2022Quote: ... in dimethyl sulfoxide (DMSO) (D128-500, ThermoFisher Scientific). Glycerol was added at least one day after other reagents started mixing and after urea and D-sorbitol were sufficiently dissolved in DMSO ...
-
bioRxiv - Neuroscience 2023Quote: ... were dissolved in dimethyl sulfoxide (DMSO; Fisher Scientific) as stock solutions (5-10LJmM ...
-
bioRxiv - Cancer Biology 2024Quote: ... Dimethyl Sulfoxide (DMSO) was purchased from Thermo Fisher Scientific (BP231-100) ...
-
bioRxiv - Developmental Biology 2022Quote: ... diluted in 10% dimethyl sulfoxide (DMSO) (Fisher Scientific) for 30 min at room temperature (RT ...
-
bioRxiv - Biophysics 2024Quote: ... and 0.3% dimethyl sulfoxide (Life Technologies, Darmstadt, Germany) as control.
-
bioRxiv - Systems Biology 2024Quote: ... 2-3 butanediol, and erythritol), and organic acids (acetate, succinate, tartrate, citrate, and malate) were determined using an HPLC (Thermo Fisher Scientific, Waltham, MA) equipped with a refraction index and UV/VIS (210nm ...
-
bioRxiv - Immunology 2022Quote: ... for 3 min and incubated in 1% phosphomolybdic acid then acetic acid solution (A38C-212; Thermo Fisher Scientific, Waltham, MA) for 5 min and 3 min ...
-
bioRxiv - Microbiology 2021Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). SARS-CoV-2 standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g.
-
bioRxiv - Cancer Biology 2021Quote: ... 10 ng/ml IL-6 and 10 ng/ml IL-3 (Gibco). Inpp4b+/+ and Inpp4b-/- LSK were each retrovirally transduced with pMSCV-MLL-AF9-IRES-mVenus ...
-
bioRxiv - Microbiology 2023Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). SARS-CoV-2 standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g ...
-
bioRxiv - Immunology 2024Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). EBOV or MARV standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g.
-
bioRxiv - Cell Biology 2024Quote: ... 3-4 or 5-6 and Phusion DNA polymerase (Thermo Fisher Scientific). The resulting PCR mix was DpnI digested and 4 μl of the mix was used for transformation of E ...
-
bioRxiv - Immunology 2021Quote: ... 2 mM MEM non-essential amino acids (Life Technologies #11140050), 10 mM HEPES (Life Technologies #15630080) ...
-
bioRxiv - Systems Biology 2021Quote: ... 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Gibco), and 1× MEM non-essential amino acids solution (Gibco) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2-Mercaptoethanesulphonic Acid (MESNA) was purchased from Acros Organics (443150250). The primary antibodies used included anti-occludin ...
-
bioRxiv - Microbiology 2020Quote: ... 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Gibco), and 1X MEM non-essential amino acids solution (Gibco) ...
-
bioRxiv - Immunology 2020Quote: ... with 2-(N-morpholino) ethanesulfonic acid (MES) buffer (Novex, Invitrogen) at 150V for 60 to 90 minutes ...
-
bioRxiv - Genomics 2023Quote: ... 2 mM MEM non-essential amino acids (Life Technologies #11140050), 10 mM HEPES (Life Technologies #15630080) ...
-
bioRxiv - Biochemistry 2023Quote: ... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Acros Organics, ThermoFisher), Magnetic nanobeads (Ocean Nanotech ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 mM L-glutamine and 1% nonessential amino acids (Invitrogen) (DMEM complete ...
-
bioRxiv - Cell Biology 2023Quote: ... 20 nM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Gibco) and 50 µM 2-Mercaptoethanol (Gibco ...
-
bioRxiv - Biochemistry 2023Quote: ... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Acros Organics, ThermoFisher), Magnetic nanobeads (Ocean Nanotech ...
-
bioRxiv - Systems Biology 2024Quote: ... 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Gibco), and 1X MEM non-essential amino acids solution (Gibco) ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 mM ethylenediaminetetraacetic acid (EDTA, Thermo Fisher Scientific, Waltham, MA), and 2.5% polyvinylpyrrolidone (PVP ...
-
bioRxiv - Biochemistry 2020Quote: ... The proteins were incubated with 20-fold molar excess of either IANBD [N,N’-dimethyl-N-(iodoacetyl)-N’-(7-nitrobenz-2-oxa-1,3-diazol)ethylenediamine or Alexa Fluor 546 (AF546) maleimide (Molecular Probes] for 2 h at RT ...
-
bioRxiv - Biochemistry 2020Quote: ... The proteins were incubated with 20-fold molar excess of either IANBD [N,N ′ -dimethyl-N-(iodoacetyl)-N’-(7-nitrobenz-2-oxa-1,3-diazol) ethylenediamine or Alexa Fluor 546 (AF546) maleimide (Molecular Probes] for 2 h at RT ...
-
bioRxiv - Microbiology 2021Quote: ... the formazan crystals were dissolved in 100 µl of a 1:2 mixture of dimethyl sulfoxide (DMSO, Invitrogen, Cat#D12345) and ethanol ...
-
bioRxiv - Biochemistry 2021Quote: ... with a 10-fold excess of N,N’-dimethyl-N-(iodoacetyl)-N’-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) ethylenediamine (IANBD-amide, Molecular Probes). After 90 min on ice ...
-
bioRxiv - Bioengineering 2024Quote: ... The 1mM stock solution of Rhod-2 is prepared by mixing 44.5 µL dimethyl sulfoxide (DMSO, Thermo Fisher Scientific Inc) with 50 µg Rhod-2 AM (Invitrogen) ...
-
bioRxiv - Biochemistry 2024Quote: ... that was pre-conjugated to Protein A/G beads (Pierce, 88802) for 2 h 4 °C (note: pre-conjugation crosslinked using 20 mM dimethyl pimelimidate (DMP, ThermoFisher) in borate buffer (40 mM boric acid ...
-
bioRxiv - Biochemistry 2024Quote: ... that was pre-conjugated to Protein A/G beads (Pierce, 88802) for 2 h 4 °C (note: pre-conjugation crosslinked using 20 mM dimethyl pimelimidate (DMP, ThermoFisher) in borate buffer (40 mM boric acid ...
-
bioRxiv - Developmental Biology 2020Quote: ... (N-((6-(2,4-DNP)Amino)Hexanoyl)-1-(BODIPY® F C5)-2-Hexyl-Sn-Glycero-3-Phosphoethanolamine) was purchased from Molecular Probes (Melbourne, VIC, Australia). The TiO2 was collected from a disassembled column ...
-
bioRxiv - Neuroscience 2024Quote: ... Peptides were loaded onto a C18 pre-column (3 μm, 75 mm i.d. × 2 cm, 100 Å, Thermo Fisher Scientific Cat# 16-494-6) then separated on a reverse-phase nano-spray column (2 μm ...