Labshake search
Citations for Thermo Fisher :
3351 - 3400 of 10000+ citations for 6 Chloro 7 fluoro 1H indole 2 3 dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... The resulting cDNA was utilized for quantitative qPCR (Viia 7; Applied Biosystems). cDNA was diluted 1:50 in H20 and mixed with 10μM primers and PowerSYBR Green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were cultured for 7 days in medium containing HAT Supplement (Gibco) followed by 4 days in HT Supplement (Gibco ...
-
bioRxiv - Neuroscience 2023Quote: ... These were mixed with a solution containing 7 µl Lipofectamine 3000 (Invitrogen) in 250 µl OptiMEM ...
-
bioRxiv - Biophysics 2023Quote: ... with an QuantStudio™ 7 Flex Real-Time PCR System (ThermoFisher Scientific). Data analysis was performed as described previously84.
-
bioRxiv - Developmental Biology 2023Quote: Samples were loaded and run in a 7% Tris-acetate gel (Invitrogen) in tris-acetate buffer on ice at 45V ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were cultured in RPMI-1640 (Raji, Daudi, Ramos, MCF-7) (Gibco) or DMEM (E0771 ...
-
bioRxiv - Cell Biology 2023Quote: Real-time qPCR was performed on ViiA™ 7 system (Applied Biosystems). Total volume of qPCR reaction was 20µl and it contained 10µl of 2x qPCR Master Mix Low ROX (Eurogentec) ...
-
Evolutionary Adaptation of an HP1-protein Chromodomain Integrates Chromatin and DNA Sequence SignalsbioRxiv - Genetics 2024Quote: ... 0.15 M NaF using Zeba 7 kDa spin desalting columns (ThermoFisher Scientific) then diluted to approximately 50 µM in the desalting buffer ...
-
bioRxiv - Cancer Biology 2024Quote: MCF-7 cells were transfected with Silencer Select siRNA (Thermo Fisher Scientific) against XIAP (s1454 ...
-
bioRxiv - Cell Biology 2024Quote: ... The qPCR was conducted and analyzed on ViiA 7 System (Applied Biosystems). The following Taqman probes were used ...
-
bioRxiv - Immunology 2024Quote: ... Cells were washed and resuspended in 7-aminoactinomycin D (Thermo Fisher Scientific) for dead cell exclusion.
-
bioRxiv - Neuroscience 2024Quote: ... qRT-PCR was then performed using a QuantStudio 7 Pro (Applied Biosystems) in standard mode ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1/7 of the cytoplasmic fraction was resuspended in TRIZOL (Thermo Fisher). Instead ...
-
bioRxiv - Neuroscience 2024Quote: ... and brought to pH=7 with 10N NaOH (Fisher Scientific, Cat#SS2551). ANL solution was made fresh before treatment and can be kept at 4°C for short-term storage (freeze-thaw sometimes produces hard-to-redissolve precipitation) ...
-
bioRxiv - Molecular Biology 2024Quote: ... analysed with the QuantStudio 7 Flex Real-Time PCR System (Thermo Scientific). The primers were designed using Primer BLAST65 and are listed in Supplementary Table 5.
-
bioRxiv - Cell Biology 2024Quote: ... MCF-7 cells were cultured in RPMI 1640 (Thermo Fisher Scientific, 61870010) supplemented with 10% heat-inactivated fetal calf serum and penicillin/ streptomycin ...
-
bioRxiv - Bioengineering 2024Quote: ... Excess dye was removed via 7 kDa desalting columns (Zeba Spin, ThermoFisher) and validated via thin-layer chromatography.
-
bioRxiv - Biochemistry 2021Quote: ... and/or ToPro-3-3 (1 μM; Thermo-Fisher Scientific, Waltham, MA) for 10 minutes at RT ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) was purchased from Life Technologies/Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... #3: 5′-GAAUAUUGAACUGGAAGCAGCACAU-3′) were purchased as Stealth RNAi siRNAs from Invitrogen. The target sequences were designed using the Block-iT RNAi Designer tool (Invitrogen ...
-
bioRxiv - Genetics 2022Quote: ... 20 mL of 3 mM of 3-deoxyadenosine (cordycepin; Thermo Fisher Scientific) was added to the buffer to obtain a final concentration of 0.6 mM (150 mg/L) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... the oligonucleotides 5’-CCTGTGCAGCCGTCCATAGGGCCTGTCAGTCAGTGGCCAAAACAGGCCTAT GAGGACGGCTGCAC-3’ and 5’-TGCTGTGCAGCCGTCCTCATAGGCCTGTTTTGGCCACTGACTGACAGGCCTATGGACGGCTGCA-3’ (#Mmi520981, Invitrogen) were used ...
-
bioRxiv - Cancer Biology 2019Quote: ... 300,000/6-well) and IDC (5,000/96-well; 100,000/6-well) cells were seeded in regular (Thermo Fisher Scientific) or ULA (Corning Life Sciences ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Supernatant obtained from the BALF was used to measure the endogenous release of IL-6 using a commercially available Murine IL-6 ELISA kit according to the manufacturer’s instructions (ThermoFisher, InVItrogen). The absorbance was read at 450 nm and secreted IL-6 was analyzed using Gen5 data analysis software (BioTek Instruments ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNAs were forward transfected in 6-well dishes by using 6 μl of FuGENE® HD (PRE2311, Fisher Scientific) with 3 μg of sgRNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... for the first 24 hours and for further 4 to 6 days in Essential 6 media (Thermo Fisher Scientific).
-
bioRxiv - Pathology 2020Quote: ... CHO cells were transfected with 5 ug of human cadherin-6 in pIRES-puro or mouse cadherin-6 in pCDNA3.1 via Lipofectamine 2000 (Invitrogen). After 48hrs ...
-
bioRxiv - Molecular Biology 2021Quote: ... fluorescence-labeled HIV-1JR-FL Env(-) carrying the (His)6 epitope tag was incubated with biotin-conjugated anti-(His)6 tag antibody (HIS.H8, Invitrogen) at 4° for two hours.
-
bioRxiv - Cell Biology 2020Quote: Cells in the 6-well plates were transfected with 2μg plasmid of AMPKα or OGG1 via 6 μl Lipofectamine 2000 (Invitrogen) for 6 hours following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... The Cas9-sgRNA-containing plasmid and donor vector were co-transfected at a molar ratio of 1:6 into XX mESCs cells on a 6-well plate using Lipofectamine 2000 according to the manufacturer’s protocol (ThermoFisher). Transfected cells were passaged at different densities into three Petri dishes with feeders ...
-
bioRxiv - Biochemistry 2021Quote: ... 6% native PAGE gels were prepared by first making a gel solution containing 6% acrylamide (29:1) (Fisher Scientific).15 This solution was then degassed under vacuum and mixing ...
-
bioRxiv - Neuroscience 2019Quote: ... Cells were washed twice with PBST followed by 1h incubation at RT with anti-rabbit Alexa FluorTM 488 (1:200; Thermo Fisher Scientific, A11001) and Alexa FluorTM 568 phalloidin (1:200 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were then incubated for 1h with secondary antibodies conjugated with Alexa Fluor 594 fluorescent dyes (Molecular Probes, 1:400 dilution in PBS+). Then ...
-
bioRxiv - Biophysics 2019Quote: ... The membranes were incubated for 1h with 1:2000 dilution of HRP conjugated anti-FLAG monoclonal antibody (Thermo Fisher Scientific MA1-91878-HRP) at room temperature ...
-
bioRxiv - Developmental Biology 2021Quote: ... Immunolabeling with performed with mouse anti-B23 primary antibody (1:300; 2h) then detected with Alexa 488 donkey anti-mouse antibody (Invitrogen; 1:500; 1h), then further fixed with 4% paraformaldehyde in DEPC-PBS ...
-
bioRxiv - Genomics 2020Quote: ... After incubation for 1h with a secondary fluorescently labelled antibody in BS (1:1000) the tissue was stained with 1:100 YOYO1 (Molecular Probes, Life Technologies) for 15 min and mounted with Vectashield Antifade Mounting Medium (H-1000 ...
-
Disruption of the TCA cycle reveals an ATF4-dependent integration of redox and amino acid metabolismbioRxiv - Biochemistry 2021Quote: ... Samples were loaded onto 4-12% Bis-Tris Bolt™ gradient gels and run at 160V constant for 1h in Bolt™ MES 1X running buffer (Thermo Scientific). Dry transfer of the proteins onto a nitrocellulose membrane was done using iBLOT2 (Thermo Scientific ...
-
bioRxiv - Physiology 2023Quote: ... at 37°C for 1h and subsequently with donkey anti-rabbit IgG (H+L) Highly Cross-Adsorbed Secondary AntibodyAlexa-647 (ThermoFisher Scientific #A-31573) at 37°C for 1h ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were centrifuged (300rcf, 7min, 4°C) and fixed (1h, 4°C) using the eBioscience Foxp3/Transcription factor staining buffer set (ThermoFisher #00-5523-00) fixation/permeabilization reagent ...
-
bioRxiv - Molecular Biology 2024Quote: ... Proper secondary antibodies were used for 1h at room temperature before visualised the membranes with Pierce™ ECL Western Blotting Substrate (Thermo Scientific, 10005943) or SuperSignal™ West Pico PLUS Chemiluminescent Substrate (Thermo Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... OCT-embedded penis sections were permeabilized in PBS with 0.3% Triton X-100 at room temperature for 10 min following by 1h incubation with blocking buffer containing 10% normal goat serum (Life Technologies, 16210-072) and 0.1% Tween20 in PBS at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the slides were blocked for 1h at RT with 1XPBS + 10% normal goat serum (NGS, 60.0 mg/mL, Thermo Fisher Scientific, Ghent, Belgium) and 1%FBS and washed again twice with 1XPBS for 5’ each ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were washed 3x for 5 min with PBS and incubated for 1h at RT with Alexa Fluor® conjugated secondary antibodies (Table S3) and nuclei stain Hoechst 33342 (Invitrogen cat.no. 62249). After 3x washes for 5 min with PBS ...
-
bioRxiv - Genomics 2020Quote: ... Day 3 SP34 (Invitrogen) with 5 ng/ml BMP4 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3’-Diaminobenzidine (Invitrogen, 750118) as a substrate ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 mM DTT (Invitrogen) and 40 units RNAse OUT (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μM MMC (ThermoFisher) for 6 hours ...
-
bioRxiv - Cell Biology 2022Quote: A 3% agarose (Invitrogen) gel solution was prepared in PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... IL-3 (Life Technologies), Dexamethasone (Sigma) ...