Labshake search
Citations for Thermo Fisher :
3201 - 3250 of 10000+ citations for hsa mir 23b Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... and real-time detection and quantification of cDNAs was performed on the Viia7 Cycler (Applied Biosystems) with 40 cycles of amplification ...
-
bioRxiv - Biochemistry 2020Quote: ... Transcript levels were determined with RT-qPCR using StepOnePlus™ Real-Time OCR Systems (Applied Biosystems) on the cDNA matrix ...
-
bioRxiv - Cancer Biology 2020Quote: ... Quantitative real-time PCR analysis was conducted on an ABI 7500 Real-Time PCR system using PowerSYBR® Green PCR Master Mix (Thermo Fisher Scientific, Waltham, USA). Primer-specific annealing temperatures were pre-evaluated prior to the study to optimize PCR conditions ...
-
bioRxiv - Immunology 2019Quote: ... Real-time assays were conducted using TaqMan real-time probes (Applied Biosystems). ΔΔ CT method was used for relative gene expression ...
-
bioRxiv - Neuroscience 2021Quote: ... the shRNA construct was obtained by cloning the sequence into pcDNA6.2-GW/EmGFP-miR plasmid using a microRNA (miR)-based expression vector kit (BLOCK-iT Pol II miR; Invitrogen), thereby creating an expression cassette consisting of the 5′ miR flanking region ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20 U Ribolock (40U/μl), 1x TaqMan RT primer per each gene of interest (miR-7a, miR-671, Let-7a, snoRNA202, U6 snRNA) (Applied Biosystems) and 1x first-strand synthesis buffer were filled up to 20 μl reaction volume with ddH2O and mixed ...
-
bioRxiv - Plant Biology 2019Quote: ... cDNA synthesis was performed using Thermo Scientific Verso cDNA synthesis kit following manufacturer‟s instructions and qRT-PCR was performed in StepOne™ Real-Time PCR Systems (Applied Biosystems, USA) as described in Singh et al ...
-
bioRxiv - Molecular Biology 2019Quote: ... Expression levels were determined by qRT-PCR using Applied Biosystems StepOnePlus™ Real-Time PCR System with Fast SYBR™ Green Master Mix kit (Applied Biosystems) using ...
-
bioRxiv - Genetics 2022Quote: ... Quantitative PCR was performed using Power SYBR™ Green PCR Master Mix kit on a StepOne Plus real time PCR system (Applied Biosystems, Foster City, CA, USA). The relative expression level of a gene was normalized by that of GDPDH ...
-
bioRxiv - Neuroscience 2022Quote: ... Real-time PCR was performed on the ABI 7500 Real-Time PCR System using the TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific). All primers are listed in Table S12 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Real-time PCR of diluted ChIP DNA and corresponding input DNA was performed on ViiA 7 Real-Time PCR system (Thermo Fisher Scientific). Primer sequences used for ChIP are listed in Supplementary Table 1 ...
-
bioRxiv - Neuroscience 2024Quote: ... Real-time PCR was performed on the ABI 7500 Real-Time PCR System using the TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific). All primers are listed in Table S12 ...
-
bioRxiv - Neuroscience 2024Quote: ... Real-time PCR was performed on the ABI 7500 Real-Time PCR System using the TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific). All primers are listed in Supplementary Table S2 ...
-
bioRxiv - Immunology 2019Quote: ... Quantitative real-time PCR (qRT-PCR) was performed in triplicate using Taqman® Universal PCR Master Mix (Applied Biosystems) in total reaction volumes of 20 μL and thermocycled in a CFX284 TouchTM Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Quantitative real-time PCR (qRT-PCR) reactions were carried out using Power SYBR green PCR Master Mix (Applied Biosystems) and the StepOnePlus Real Time PCR System (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2022Quote: ... Quantitative reverse transcription-PCR (qRT-PCR) was performed on a Quant Studio 3 Real-Time PCR system (Thermo Fisher) with the KAPA SYBR Fast qPCR kit (KAPA Biosystems) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The quantitative reverse transcription PCR (qRT-PCR) was run on the StepOnePlus Real-time PCR System (Applied Biosystems, USA), and relative quantification was performed using the 2−ΔΔCT method ...
-
bioRxiv - Cell Biology 2021Quote: ... Calu-3 cells were seeded at 2.5×105/ml with 100 or 300 nM of hsa-miR-145-5p miRNA precursor (PM11480, Ambion, Thermo Fisher Scientific). After 72 h ...
-
bioRxiv - Bioengineering 2022Quote: ... PACE60 nanoparticles were formulated as described previously by double emulsion solvent evaporation using miR200b mimic (Invitrogen mirVana miRNA Mimic, hsa-miR-200b-3p, 5’-UAAUACUGCCUGGUAAUGAUGAC −3’, Cat# 4464066, Ambion, Austin, TX) or a negative control miR (Invitrogen mirVana miRNA Mimic ...
-
bioRxiv - Cancer Biology 2022Quote: ... RT-PCR was performed with an ABI Prism 7300 detection apparatus (Applied Biosystems, Courtaboeuf, France) using the Taqman Universal Master Mix according to the manufacturer’s recommendations ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... was used as the fluorescence detection dye with an RT-PCR machine (StepOnePlus, Applied Biosystems, Foster City ...
-
bioRxiv - Molecular Biology 2021Quote: ... Quantification was performed using the library quantification kit using a StepOne Real-Time PCR System (Life Technologies, Inc., USA). High-throughput sequencing was performed as paired-end 100 sequencing using HiSeq X10 (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... Quantification was performed using the library quantification kit using a StepOne Real-Time PCR System (Life Technologies Inc., USA). High throughput sequencing was performed as paired-end 100 sequencing using HiSeq 2500 (Illumina Inc. ...
-
bioRxiv - Cancer Biology 2021Quote: ... Quantification was performed using the library quantification kit using a StepOne Real-Time PCR System (Life Technologies, Inc., USA). High-throughput sequencing was performed as paired-end 100 sequencing using HiSeq X10 (Illumina ...
-
bioRxiv - Synthetic Biology 2021Quote: ... We used SensiFAST Probe No-ROX One-Step Kit (Meridian Bioscience) and PikoReal Real-Time PCR System (Thermo Scientific) with following cycling conditions ...
-
bioRxiv - Cell Biology 2019Quote: ... real-time thermal cycler using the SYBR® Green PCR Master Mix kit (Applied Biosystems, Foster City, CA, USA) with the following thermal cycler settings ...
-
bioRxiv - Genomics 2021Quote: ... using the TaqPath COVID-19 Combo Kit with an Applied Biosystems 7500 Fast Dx Real-Time PCR instrument (ThermoFisher) for SARS-CoV2 detection ...
-
bioRxiv - Developmental Biology 2022Quote: ... For real-time PCR analysis cDNA was synthesized with the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, 4368813) and real-time qPCR was performed using either the PowerUp SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2022Quote: ... and 2019-nCov CDC EUA Kit (Integrated DNA Technologies) with 7500 Fast Dx Real-Time PCR Instrument (Applied Biosystems).
-
bioRxiv - Microbiology 2022Quote: ... using qScript 1-Step SYBR Green qPCR kit (Quantabio) on a ViiA 7 Real-Time PCR System (Applied Biosystems); 16S rRNA was used for normalization ...
-
bioRxiv - Cell Biology 2022Quote: ... quantified using real-time PCR and the Qubit dsDNA HS Assay kit on a Qubit 2.0 fluorometer (Thermo Scientific). The quantified libraries were pooled in equimolar ratio and sequenced on a NovaSeq 6000 (Illumina).
-
bioRxiv - Developmental Biology 2023Quote: ... Real-time quantitative PCR (qPCR) was performed using a StepOne thermocycler with a Sybr green mix kit (Applied Biosystems). Primer sequences were chosen for Eln (forward ...
-
bioRxiv - Microbiology 2022Quote: ... RT-PCR was conducted using a SuperScript™ III One-Step RT-PCR kit (Invitrogen, Carlsbad, CA, USA) to amplify the extracted viral RNA (Qiagen) ...
-
bioRxiv - Microbiology 2019Quote: ... Quantitative RT-PCR was then performed with TaqMan RNA-to-Ct One-step RT-PCR kit (Applied Biosystems) using the following cycling conditions ...
-
bioRxiv - Immunology 2020Quote: ... RT-PCR was carried out using TaqMan® One-Step RT-PCR master mix reagents kit (Applied Biosystems) with HCV primers (sense S66 [ACGCAGAAAGCGTCTAGCCAT] and anti-sense A165 [TACTCACCGGTTCCGCAGA] ...
-
bioRxiv - Microbiology 2023Quote: ... RT–PCR was performed using a Superscript III One-Step RT-PCR kit (Thermo Fisher Scientific, CA, USA) and an ABI StepOnePlus PCR system (Applied Biosystems ...
-
bioRxiv - Plant Biology 2019Quote: Gene expression was studied by quantitative real-time PCR (StepOne plus, Applied Biosystems) using the Power SyBR Green master mix (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2019Quote: ... using a QuantStudio™ 12K Flex Real-Time PCR System (Thermo Fisher Scientific) to determine the expression levels of GAD1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... in a ViiA 7 or 7900 HT Real-Time PCR system (Applied Biosystems). Data analysis was performed using the RQ Manager (Applied Biosystem ...
-
bioRxiv - Cell Biology 2020Quote: ... in an Applied Biosystems 7500 Fast Real-time PCR System (Thermo Fisher Scientific). Relative mRNA levels of the indicated genes were calculated by the 2-DDCT method (Bulletin 5279 ...
-
bioRxiv - Immunology 2021Quote: ... qPCR was performed on the QuantStudio 3 Real-Time PCR System (Applied Biosystems) using SYBR Green ...
-
bioRxiv - Immunology 2021Quote: ... on the QuantStudio 5 or QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific). Relative transcript levels were normalized to TATA-binding protein (Tbp ...
-
bioRxiv - Developmental Biology 2021Quote: ... Quantitative real-time PCR was performed using the SYBR Green system (Applied Biosystems) with primers listed in Supplemental Table 8 ...
-
bioRxiv - Microbiology 2021Quote: ... qPCR reactions were performed using a StepOnePlus Real-Time PCR system (Applied Biosystems) and PowerUp SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... was used on the QuantStudio 6 Flex real-time PCR system (Applied Biosystems). Primers specific for miR-2-5p ...
-
bioRxiv - Microbiology 2020Quote: ... Reactions were performed on a QuantStudio 3 Real-Time PCR System (Thermo Fisher) with the amplification conditions as previously described (14).
-
bioRxiv - Developmental Biology 2021Quote: ... qPCR was done on QuantStudio 3 Real Time PCR Systems (Thermo Fisher Scientific) with the TaqMan gene expression Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... reactions were run on a ViiA 7 Real-Time PCR System (Applied Biosystems) using the following program ...
-
bioRxiv - Neuroscience 2021Quote: ... Complementary DNA was amplified on a ViiA7 Real-Time PCR system (Thermo Scientific) with POWRUP SYBR Green Master Mix (cat# 4368706Thermo Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... qPCR was done on the StepOnePlus Real-Time PCR System (ThermoFisher, Waltham, MA) using TaqMan Universal PCR Master Mix.