Labshake search
Citations for Thermo Fisher :
3101 - 3150 of 10000+ citations for 5 Alpha dihydroprogesterone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... whereas from July 2022 onwards loading was performed onto a new trap column (PepMap Acclaim C18, 5 mm × 300 μm ID, 5 μm, 100 Å, Thermo Fisher Scientific) at a flow rate of 20 µL/min over 2 min ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.1% (v/v) TFA in water and injected onto a C18 PepMap100-trapping column (0.3 × 5 mm, 5 µM, Thermo Fisher Scientific, Waltham, USA) coupled to a C18 analytical column packed in-house (75 µM × 300 mm ...
-
bioRxiv - Cell Biology 2024Quote: ... The HPLC coupled to the LTQ Orbitrap XL was equipped with two PepMapTM C18 μ-precolumns (ID: 0.3 mm × 5 mm, 5 µm, 300 Å Thermo Fisher Scientific) and an AcclaimTM PepMapTM analytical column (ID ...
-
bioRxiv - Biochemistry 2024Quote: ... whereas from Jan 2022 onwards loading was performed onto a new trap column (PepMap Acclaim C18, 5 mm × 300 μm ID, 5 μm, 100 Å, Thermo Fisher Scientific) at a flow rate of 20 µL/min over 2 min ...
-
bioRxiv - Microbiology 2024Quote: Total RNA extracted from BoDV-2-infected Vero cells was ligated with either 5’ adaptor oligoRNA (5’-CGACUGGAGCACGAGGACACUGACAUGGACUGAAGGAGUAGAAA (Thermo Fisher Scientific, USA; #L150201)) or 3’ adaptor oligoRNA (5’-GAAGAGAAGGUGGAAAUGGCGUUUUGG ...
-
bioRxiv - Cell Biology 2024Quote: ... Peptides were trapped on a C18 Acclaim PepMap 100 (5 μm, 300 μm x 5 mm) trap column (ThermoFisher Scientific, San Jose, USA) and eluted onto a C18 Acclaim PepMap100 3 μm ...
-
bioRxiv - Biochemistry 2024Quote: ... whereas from Jan 2022 onwards loading was performed onto a new trap column (PepMap Acclaim C18, 5 mm × 300 μm ID, 5 μm, 100 Å, Thermo Fisher Scientific) at a flow rate of 20 µL/min over 2 min ...
-
bioRxiv - Developmental Biology 2024Quote: Peptides were loaded onto a trap column (PepMap Acclaim C18, 5 mm × 300 μm ID, 5 μm particles, 100 Å pore size, Thermo Fisher Scientific) at a flow rate of 25 μl/min using 0.1% TFA as mobile phase ...
-
bioRxiv - Cancer Biology 2024Quote: ... Real-time PCR targeting PTPRZ1 (5’-ACTCTGAGAAGCAGAGGAG-3’ and 5’-CTGTTGTCTGTAGTATCCATTAG-3’) or GAPDH (5’-TCAAGGCTGAGAACGGGAAG-3’ and 5’-CGCCCCACTTGATTTTGGAG-3’) was performed with Power SYBR™ Green PCR Master Mix (Applied Biosystems 4367659) in three technical replicates.
-
bioRxiv - Plant Biology 2024Quote: ... Peptides were loaded onto a trap column (PepMap Acclaim C18, 5 mm × 300 μm ID, 5 μm particles, 100 Å pore size, Thermo Fisher Scientific) at a flow rate of 25 μl/min using 0.1% TFA as mobile phase ...
-
bioRxiv - Molecular Biology 2024Quote: ... Peptides were loaded onto a trap column (PepMap Acclaim C18, 5 mm × 300 μm ID, 5 μm particles, 100 Å pore size, Thermo Fisher Scientific) at a flow rate of 25 μL/min using 0.1% TFA as mobile phase ...
-
bioRxiv - Plant Biology 2024Quote: Peptides were loaded onto a trap column (PepMap Acclaim C18, 5 mm × 300 μm ID, 5 μm particles, 100 Å pore size, Thermo Fisher Scientific) at a flow rate of 25 μl/min using 0.1% TFA as mobile phase ...
-
bioRxiv - Systems Biology 2024Quote: ... one microgram of a sample was loaded into a 5 mm trap column packed with 5 µM/100 Å C18 material (Thermo Fisher Scientific) using 98% buffer A (0.1% formic acid in water ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were then washed twice in PBS/0.1% Triton-X/5% Goat Serum for 5 minutes each and 200 nM Alexa Fluor 488 phalloidin (Thermo Fisher, Catalog No. A12379) was added for 1 hr ...
-
bioRxiv - Cancer Biology 2024Quote: ... Peptides were loaded onto a trap column (PepMap C18, 5 mm × 300 μm ID, 5 μm particles, 100 Å pore size, Thermo Fisher Scientific) by using 0.1% TFA ...
-
bioRxiv - Cancer Biology 2024Quote: ... Samples were loaded onto an RP C18 pre-column (Acclaim PepMap, 300 μm x 5 mm, 5 μm, 100 Å, Thermo Fisher Scientific) and washed with 0.1% (v/v ...
-
bioRxiv - Evolutionary Biology 2024Quote: Peptides were loaded onto a trap column (PepMap Acclaim C18, 5 mm × 300 µm ID, 5 µm particles, 100 Å pore size, Thermo Fisher Scientific) at a flow rate of 25 µl/min using 0.1% TFA as mobile phase ...
-
bioRxiv - Microbiology 2020Quote: ... Ultrathin sections of 50 nm were blocked with 5% fetal bovine serum/5% normal goat serum for 30 min and subsequently incubated with rabbit anti-GFP antibody (Life Technologies Corp., Eugene, OR) for 60 min at room temperature ...
-
bioRxiv - Systems Biology 2022Quote: Vector backbone was prepared by digesting 5 μg of CROPseq-CaptureSeq-Guide-Puro with 5 μl of FastDigest Esp3I (Thermo Scientific cat. no. FD0454) in a total volume of 50 μl 1× Thermo Scientific FastDigest Green Buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... peptides were loaded on an Acclaim PepMap 100 μ-precolumn cartridge (5 μm, 100 Å, 300 μm ID x 5 mm, Thermo Fisher Scientific). Then ...
-
bioRxiv - Biochemistry 2021Quote: ... The 5 mL HisTrap column was washed with 10 column volumes of wash buffer (2× GIBCO 14200-075 PBS, 5 mM Imidazole, pH 7.5) followed by 6 column volumes of elution buffer (2× GIBCO 14200-075 PBS ...
-
bioRxiv - Neuroscience 2020Quote: 20ng of DNA was amplified for PSEN1-Exon6 using forward (5’ GGTTGTGGGACCTGTTAATT 3’) and reverse (5’ CAACAAAGTACATGGCTTTAAATGA 3’) primers with AmpliTaq Gold® 360 PCR Master Mix (Thermofisher, Waltham, MA, USA). Sanger sequencing was performed using BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermofisher ...
-
bioRxiv - Bioengineering 2022Quote: ... All the cells were cultured at 37°C in 5% CO2 using 5 mL of Dulbecco modified Eagle medium (DMEM, Thermo Fisher Scientific, MA, USA)–high-glucose (4500 mg of D-glucose/liter ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Developmental Biology 2020Quote: The retinas of juveniles (n = 6 retinas from 5 animals) and adults (n = 5 retinas from 4 animals) were dissected out and put in RNAlater (Ambion Inc., Austin, TX, USA). RNA extraction was performed using the RNeasy mini kit (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... Ultrathin sections of 50 nm were blocked with 5% FBS/5% NGS for 30 min and subsequently incubated with rabbit anti-GFP (Life Technologies Corporation, Carlsbad, CA.)(1:200 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 7.5 mg of antibody-coupled beads and 5 mg empty beads were used with the Dynabeads™ Co-Immunoprecipitation Kit (Thermo Fisher Scientific; 14321D) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... the cells within explants were fluorescently labeled with 5 µg/mL of 5-chloromethylfluorescein diacetate (CellTracker™ Green; Thermo Fisher Scientific Inc., Waltham, MA) in serum-free media (DMEM with 1% PSF ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were washed with PBS 3-5 times for 5 minutes each and mounted with ProLong Gold Antifade Mountant (#P36930, Thermo Fisher Scientific, Waltham MA). Confocal images were taken with the 20x and 40x (oil ...
-
bioRxiv - Immunology 2024Quote: ... and OtsuR747 (5’- TATGCCTGAGTAAGATACGTGAATGGAATT-3’) primers (IDT, Coralville, IA) and detected with the probe OtsuPr665 (5’-6FAM- TGGGTAGCTTTGGTGGACCGATGTTTAATCT-TAMRA) (Applied Biosystems, Foster City, CA) by SsoAdvanced Universal Probes Supermix (Bio-Rad ...
-
bioRxiv - Microbiology 2024Quote: ... The samples were trapped on a C18 trap column (Acclaim PepMap100 C18, 5 µm, 300 µm x 5 mm, Thermo Fisher Scientific, Waltham, MA) for 2 min before separation on an Easy-Spray™ C18 nano column (75 µm x 150 mm ...
-
bioRxiv - Microbiology 2023Quote: ... Peptides were loaded on an Acclaim PepMap 100 μ-precolumn cartridge (5 μm, 100 Å, 300 μm ID x 5 mm, Thermo Fisher Scientific) and separated at 40°C on a PicoTip emitter (noncoated ...
-
bioRxiv - Biophysics 2022Quote: Nascent transcription in nucleoli was measured by incorporation of 5-ethynyl uridine (5-EU) in cells using a Click-iT™ RNA Alexa Fluor™ 594 Imaging Kit (Fisher Scientific, C10330), according to the manufacturer’s recommended protocol except where noted in the following ...
-
bioRxiv - Plant Biology 2022Quote: Replicate trials of soil grown grafted plants from 3-7 days post-grafting were cut at their root tips and dipped into (5 mg/mL) of 5(-and-6)-Carboxyfluorescein Diacetate (CFDA) (Invitrogen®, Waltham, MA, USA). Plants were incubated under full-spectrum LED lights (Cirrus LED Grow Lights ...
-
bioRxiv - Neuroscience 2022Quote: ... was amplified with specific primers (forward 5’-agtcagaattcatggtgcccactggccag-3’and reverse 5’-AGTCAGGATCCTCAAGCCTTGGCTTCGACTCTT −3’) with fast digest restriction enzymes EcoRl (FD0274, Thermo Fisher Scientific, Massachusetts, USA) and BamHI (FD0054 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Presence of active BMP signalling pathway was detected by an antibody against the phosphorylated form of Smad1/5/9 protein complex (Cell Signalling Technology, Cat#13802S) or pSmad1/5 (Thermo Fisher Scientific, Cat#700047) as indicated in figures ...
-
bioRxiv - Biochemistry 2024Quote: ... 300 μm × 5 mm, 5 μm, 100 Å, separation column: C18, Acclaim PepMap, 75 μm × 500 mm, 2 μm, 100 Å, Thermo Fisher Scientific). After loading the sample on the pre-column ...
-
bioRxiv - Genomics 2024Quote: ... pylori strain was grown at 37°C in 5% CO2 on Trypticase soy agar (TSA) plates with 5% sheep blood (ThermoFisher Scientific # R01200, MA, USA) for 3 days ...
-
bioRxiv - Neuroscience 2024Quote: ... Mice were intracardially perfused for 5 minutes with ice cold 1x DPBS followed by 5 minutes of ice cold 4% paraformaldehyde (PFA; Thermo Scientific, Fair Lawn, NJ). Following perfusion ...
-
bioRxiv - Microbiology 2024Quote: ... coupled to UltiMate 3000 LC system. Trap column µ-Precolumn C18 PepMap100 (5 µm, 300 µm, i.d. 5 mm, 100 Å) (Thermo Fisher Scientific, USA) and self-packed analytical column (Inertsil 2 µm ...
-
bioRxiv - Microbiology 2024Quote: ... and equipped with FAIMS Pro interface. Trap column μ-Precolumn C18 PepMap100 (5 μm, 300 μm, i.d. 5 mm, 100 Å) (Thermo Fisher Scientific, USA) and self-packed analytical column (Reprosil-Pur 3 μm ...
-
bioRxiv - Immunology 2024Quote: ... were supplemented by 5 units of heat-inactivated (5 minutes at 80 °C) FastAP™ alkaline phosphatase (EF0651, Thermo Fisher Scientific, Waltham, MA, USA). Digestion products were purified (28104 ...
-
bioRxiv - Biophysics 2021Quote: ... 5% Fetal Calf Serum Heat Inactivated (FCS HI, Thermo Scientific) and 200μg/mL pennicilin/streptomycin (PS) ...
-
bioRxiv - Cancer Biology 2021Quote: ... was supplemented with 5 mM HEPES (Life Technologies #15630-080), 100 U/mL penicillin/streptomycin (Life Technologies #1540-122) ...
-
bioRxiv - Cell Biology 2020Quote: ... on a QuantStudio 5 Real-Time PCR System (Applied Biosystems), using manufacturer’ s recommendations ...
-
bioRxiv - Cell Biology 2020Quote: ... or DRAQ5 (1:500; 5 min; RT; Thermo Fisher Scientific).
-
bioRxiv - Immunology 2021Quote: ... During selection with 5 µg/ml blasticidin (Thermo Fisher A1113903), single clones were isolated ...
-
bioRxiv - Genetics 2021Quote: 5’ RACE was performed following manufacturer’s protocol (Invitrogen 18374-041) on total RNA harvested from WT and Rorbh1/h1 brain ...
-
bioRxiv - Genetics 2021Quote: ... with 5 μl of Lipofectamine RNAiMAX reagent (Invitrogen cat #13778) in 500 μl Opti-MEM I reduced serum medium (Invitrogen cat # 31985 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 μg/ml laminin-coated (Thermo Fisher Scientific, 23017015) four-well plates with coverslips ...