Labshake search
Citations for Thermo Fisher :
3051 - 3100 of 10000+ citations for mu p75 SAP Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Tryptic peptides were labeled with isobaric Tandem Mass Tags (TMT) according to the manufacturer’s instructions using the TMT 10-Plex Kit or TMTpro 16-Plex Kit from Thermo Fisher (Supplemental Table 4). The TMT 10-Plex reagents and TMTpro 16-plex reagents were used for labeling samples from case 343WM the remaining nine cases ...
-
bioRxiv - Developmental Biology 2020Quote: ... PCR products were purified with a FastGene Gel/PCR Extraction Kit (Nippon Genetics, Tokyo, Japan) and sequences were confirmed with a BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Waltham, Massachusetts), FastGene Dye Terminator Removal Kit (Nippon Genetics ...
-
bioRxiv - Cell Biology 2022Quote: ... The supernatant was used to measure protein concentration using the BCA kit (Pierce BCA protein assay kit #23225; Thermo Scientific, Waltham, Massachusetts, USA), and a set amount of protein was loaded for western blotting after boiling for 10 min in SDS-PAGE sample buffer.
-
bioRxiv - Cell Biology 2022Quote: ... RNA were extracted using FavorPrep™ Blood/Cultured Cell Total RNA Kit (Fisher Biotec) and quantified using Qubit™ RNA BR Assay Kit (Thermo Scientific). cDNA was synthesized using iScript™ Reverse Transcription Supermix for RT-qPCR (Bio-Rad ...
-
DNA and RNA-SIP reveal Nitrospira spp. as key drivers of nitrification in groundwater-fed biofiltersbioRxiv - Physiology 2019Quote: ... The RNA was further purified with a Qiagen AllPrep DNA/RNA Mini Kit (Hilden, Germany) and quantified with a Ribogreen RNA-quantification kit (Invitrogen, Eugene, OR, USA). Extracted rRNA (approximately 650 ng ...
-
bioRxiv - Molecular Biology 2019Quote: Total RNA was extracted from 2-5 × 106 cells using the Qiagen RNeasy Mini Kit (Cat No. 74104) and DNAse treated using Turbo DNA-free kit (Invitrogen, Cat No. AM1907) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... Purification was performed with the AMPure® XP Beads kit and quantification using the Qubit ™ dsDNA BR Assay kit (Thermo Fisher Scientific). Samples from the library ...
-
bioRxiv - Cell Biology 2019Quote: Total RNA was isolated with GeneJET RNA Purification Kit and reverse transcribed with RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Italy). The expression of SLC6A14/ATB0,+ was measured using specific forward/reverse primers (5’GCTGCTTGGTTTTGTTTCTCCTTGGTC3’ and 5’GCAATTAAAATGCCCCATCCAGCAC3’ ...
-
bioRxiv - Genetics 2021Quote: ... and Fast SYBR Green detection on an Applied Biosystems 7500 Fast cycler (reagents: ThermoFisher Scientific; TURBO DNAfree Kit, Applied Biosystems; SuperScript VILO cDNA Synthesis Kit, Invitrogen; Life Technologies; respectively) [20 ...
-
bioRxiv - Pathology 2021Quote: ... Using annexin V/Dead Cell Apoptosis Kit (Alexa Fluor 488 annexin V/Dead Cell Apoptosis Kit with Alexa Fluor 488 annexin V and propidium iodide, Invitrogen, Eugene, OR, USA), we observed more than 90% of exposed cells were deemed to be early apoptotic cells as evidence of Annexin V staining (binds to phosphatidylserine ...
-
bioRxiv - Neuroscience 2022Quote: ... a cell surface biotinylation assay was performed using a commercially available kit (Pierce Cell Surface Protein Isolation Kit, Thermo Fisher Scientific, catalog #89881). Eluates were subjected to immunoblot analysis using a Plexin-A4 antibody (Cell Signaling Technology ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA was isolated using the PureLink® RNA Mini Kit according to the kit protocol with DNase digestion (Thermo Fisher Scientific, cat# 12183025). 500ng of RNA was used to make cDNA using the Applied Biosystems High-Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2021Quote: ... Cycle sequencing was performed using the BigDye™ Terminator v3.1 Cycle Sequencing kit and products were purified with the BigDye XTerminator™ purification kit (Thermo Fisher Scientific) before to analyse them on an Applied Biosystems ABI3130 genetic analyser ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR product was purified by bead purification according to kit instructions and quantified using the Qubit ™dsDNA High Sensitivity Assay kit (Thermo Fisher Scientific).
-
bioRxiv - Pathology 2021Quote: Linearized pGH19-ASIC constructs were transcribed in vitro from the promoter using a mCAP mRNA mapping kit (mMESSAGE mMACHINE T7/SP6 kit, Ambion, Austin, TX, USA).
-
bioRxiv - Neuroscience 2020Quote: ... The lysates were then used for quantification of soluble ATP molecules using luciferase-based commercial ATP quantification kit (ATP Determination kit, Thermo Fisher, Cat.no. A22066) with the help of a standard curve ...
-
bioRxiv - Microbiology 2019Quote: Total RNAs from HepAD38 or HepG2 cells were extracted using the NucleoSpin® RNA Plus Kit (Macherey Nagel) and any DNA contaminants were digested with the Turbo DNA-free kit (Ambion, Thermo Fisher Scientific).
-
bioRxiv - Genomics 2020Quote: ... The size distribution was measured using an Agilent Bioanalyzer High Sensitivity kit and concentrations were determined using a Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific; Q32854).
-
bioRxiv - Immunology 2020Quote: ... by non-integrative Sendai Viral vector kit (CytoTune™-iPS Sendai Reprogramming Kit encoding for Oct4, Sox2, KLF4 and c-Myc, Life Technologies Cat.No.A1378001) by the Harvard Stem Cell Institute (HSCI ...
-
bioRxiv - Immunology 2021Quote: ... RNA (10 µg) preparations from colon of DSS mice were purified using the kit (Dynabeads® mRNA purification kit, Fisher Scientific, Illkirch France) according to the manufacturer recommendations ...
-
bioRxiv - Physiology 2020Quote: ... Ovalbumin was labelled with Alexa Fluor 647 with the microscale Protein labelling kit (Alexa Fluor 647 Microscale Protein Labelling Kit (Life Technologies, Darmstadt, Germany). Intratracheal instillation of 2.5 μg of OVA dissolved in 20 μl PBS was performed and held over 6 hours ...
-
bioRxiv - Immunology 2021Quote: ... CD4+ and CD8+ T cells were isolated by negative selection with the Dynabeads Untouched Human CD4 T Cells Kit and the Dynabeads Untouched Human CD8 T Cells Kit (Invitrogen, Thermo Fisher Scientific) respectively ...
-
bioRxiv - Genomics 2021Quote: ... nucleic acid quantification was measured using either Qubit™ RNA HS Assay Kit or Qubit™ dsDNA HS Assay Kit (Thermo Fisher Scientific), as appropriate.
-
bioRxiv - Microbiology 2024Quote: ... all cDNA reactions were subjected to a specific PCR reaction for CHIKV genome amplification with the Phusion PCR kit (Phusion High-Fidelity DNA polymerase kit, Thermo Scientific, ref: F530L). 5 pairs of primers were used to span all CHIKV genome (Table 3 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Further validation of RNA and DNA concentrations was performed using the Qubit RNA HS kit and Qubit dsDNA HS kit on the Qubit 2.0 Fluorometer (Life Technologies Inc., Carlsbad, CA). RNA integrity (RIN ...
-
bioRxiv - Cancer Biology 2024Quote: RNA from FACS sorted cells was purified using Single Cell RNA Purification Kit (Norgen, cat# 51800) followed by cDNA synthesis using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, cat# 4368814). Following pre-amplification of cDNA (SsoAdvanced PreAmp Supermix (BioRad ...
-
bioRxiv - Genetics 2024Quote: ... TMT-labeled peptides were fractionated into 8 fractions using the high pH reverse-phase peptide fractionation kit according to manufacturer’s instructions (Thermo Fisher Scientific) (Pierce High pH Reversed-Phase Peptide Fractionation Kit, Thermo Fisher Scientific, #84868) and subsequently dried using vacuum centrifugation.
-
bioRxiv - Immunology 2024Quote: ... eOD-GT8 60mer was directly conjugated to fluorochromes using the Alexa Fluor® 488 Antibody Labeling Kit or Alexa Fluor® 647 Antibody Labeling Kit (Thermo Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: The viability of dynamically and statically cultured cerebral organoids on day 31 was measured with the CellTiter-Glo 3D® cell viability assay kit as well as a fluorescence-based Live/Dead™ viability/cytotoxicity kit (L3224, Life Technologies) containing calcein AM and ethidium homodimer-1 (EthD-1 ...
-
bioRxiv - Genomics 2022Quote: PCR amplicons were purified using the QIAGEN QIAquick PCR Purification kit (Catalog No. 28104) and cloned using the TOPO™ XL-2 Complete PCR Cloning Kit (ThermoFisher Scientific, USA) with One Shot TOP10 Chemically Competent E ...
-
bioRxiv - Biochemistry 2022Quote: ... was taken at various time points post-transfection and luminescence was measured using Pierce™ Cypridina Luciferase Flash Assay Kit and Pierce™ Gaussia Luciferase Flash Assay Kit (both from Thermo Fisher) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... All DNA and RNA samples were quantified using Qubit® dsDNA BR assay kit and RNA HS assay kit on a qubit 2.0 fluorometer (Invitrogen, Carlsbad, CA, USA). All nucleic acid raw coextracts (containing DNA and RNA ...
-
bioRxiv - Genomics 2023Quote: DNA quantification was performed using the Qubit dsDNA HS assay kit or the Qubit dsDNA BR Assay Kit (Thermo Fisher Scientific, Massachusetts, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The amplicons were extracted and purified from the gel using the Zymo gel extraction kit according to the manufacturer’s instructions and quantified using the Quant-iT dsDNA Assay Kit (Thermo Fisher Scientific, MA, USA). Finally ...
-
bioRxiv - Microbiology 2023Quote: ... Extracellular viral RNA was extracted from 200 µl of the supernatant of mock-infected or sHCoV-infected cell cultures with Viral Nucleic Acid Extraction Kit II (Geneaid) and 10 µl were subjected to reverse transcription using SuperScript™ VILO™ cDNA Synthesis Kit (Life Technologies) as described in the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: The immunoprecipitation of endogenous PSY was performed using P-PER® Plant Protein Extraction Kit and Pierce Co-Immunoprecipitation kit (both from Thermo Fisher Scientific) following manufacturer’s instructions and is summarised below.
-
bioRxiv - Cell Biology 2023Quote: Mitochondrial membrane potential of the sperm samples was assessed with the JC-1 fluorescent probe using the kit “MitoProbe™ JC-1 Assay Kit for Flow Cytometry (M34152, Invitrogen by Thermo Fisher Scientific). Diluted sperm in SFMM was incubated for 15 min at 20 °C with JC-1 at a final concentration of 0.5 µM ...
-
bioRxiv - Microbiology 2023Quote: DNA quantification was determined fluorometrically using the Qubit 3.0 Fluorometer with the Qubit dsDNA High Sensitivity Assay Kit or the Qubit dsDNA Broad Range Assay kit (Thermo Fisher Scientific, Waltham, MA). DNA purity was determined via the 260/280 and 260/230 spectrometry ratios on a Nanodrop One (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... Cocultures were then washed with PBS and stained with LIVE/DEAD™ Fixable Blue Dead Cell Stain Kit or LIVE/DEAD™ Fixable Aqua Dead Cell Stain Kit (ThermoFisher Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Equal amounts of RNA were reverse transcribed and amplified using TaqMan™ RNA-to-C T ™ 1-Step Kit kit on the ViiA 7 Real-Time PCR System (Applied Biosystems). TaqMan gene expression assay probes (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2023Quote: ... in combination with the microRNA Booster Kit (Stemgent, Cat# 00-0073) and/or the CytoTune-iPS 2.0 Sendai Reprogramming Kit (Thermo Fisher Scientific, Cat# A16517) 25.
-
bioRxiv - Pathology 2023Quote: ... Total nucleic acids were extracted from fresh samples using the KingFisher Flex or KingFisher Purification System platforms and MagMAX-96 Viral RNA Isolation Kit or MagMAX Pathogen RNA/DNA Kit (Life Technologies, Carlsbad, California), following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... The total protein content from the crude membrane extracts was determined using the bicinchoninic acid assay 46 with a commercially available kit (Pierce™ BCA Protein Assay Kit, Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2024Quote: Total RNA was purified from the midguts and carcasses with commercially available kits (PureLink RNA Mini Kit) as recommended by the manufacturer (Thermo-Fisher Scientific, Waltham, MA). RNA sequencing (RNAseq herein ...
-
bioRxiv - Genomics 2024Quote: CD4+ and CD8+ T cells were extracted from the lymphocyte fraction using the Dynabeads CD4 Positive Isolation Kit and Dynabeads CD8 Positive Isolation Kit (Invitrogen, Waltham, MA, USA) according to the manufacturer’s protocols ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA from tissue samples was isolated using QIAGEN RNeasy kits and DNase treated with an Ambion TURBO DNA-free™ Kit (ThermoFisher Scientific, Delaware, USA). cDNA synthesis from 1.5ng/μl RNA was performed using RNA to cDNA EcoDry Premix (Random Hexamers ...
-
bioRxiv - Molecular Biology 2021Quote: ... The dialyzed rMNs were then labeled with either Alexa Fluor 488 (Green-Fluorescent) or Alexa Fluor 647 (Red-Fluorescent) with succinimidyl ester labeling kits (ARES DNA Labeling Kit, Invitrogen, Cat A21665 and A21676). The fluorescent labelled rMN were concentrated by spin-dialysis.
-
bioRxiv - Cell Biology 2022Quote: Immunoprecipitation of GFP-tagged DSB-1 was performed with the same amount of lysate determined by BCA kit (Pierce BCA protein assay kit #23225, Thermo Scientific, Waltham, Massachusetts, USA) from wild type and pph-4.1 RNAi animals ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... The PCR product was used as the template for the dsRNA synthesis with a high yield transcription kit MEGAscript T7 Kit (Thermo Fisher Scientific: Pittsburgh, PA). The dsRNA was purified using a GeneJET Gel extraction Kit (Thermo Scientific ...
-
bioRxiv - Epidemiology 2019Quote: PCR products were sequenced using BigDye Terminator v3.1 cycle sequencing kit and cleaned with BigDye XTerminator Purification kit (Applied Biosystems, Foster City, California, USA). Products were analyzed on a 3130xl Genetic Analyzer (Applied Biosystems) ...