Labshake search
Citations for Thermo Fisher :
2951 - 3000 of 7943 citations for Recombinant Human Leptin Receptor His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: rox2RNA probes at 100 nM and hrp38 RNA probes at 50nM were incubated with MBP-tagged FL CLAMPWT protein or MBP-tagged FL CLAMPdelPrLD protein in REMSA binding buffer provided with the LightShift Chemiluminescent RNA EMSA kit (Thermo Scientific, USA) at room temperature for 30 min according to manufacturer’s protocol ...
-
Srs2 binding to PCNA and its sumoylation contribute to RPA antagonism during the DNA damage responsebioRxiv - Molecular Biology 2024Quote: ... The activated form of Mec1 was enriched by immunoprecipitating myc-tagged Ddc2 using Protein A beads and anti-Myc antibody (Thermo Fisher 9E10) for 2–4 h at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... HaCaT cells were transfected with a 10 nM duplex of crRNA and Alt-R CRISPR-Cas9 tracrRNA tagged with ATTO 550 (Integrated DNA Technologies) using Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: Removal of the hexa-glutamate tag was carried out via 3C protease-based cleavage (ACRO Biosystems) for 24 hours at 4 °C followed by subtraction of the GST-tagged 3C protease via glutathione agarose (Thermo Fisher Scientific) and gel filtration (Superdex 200 ...
-
bioRxiv - Immunology 2023Quote: ... followed by staining with 1:500 goat anti-rabbit IgG (H+L) secondary antibody tagged with Alexa Fluor 647 (Invitrogen, A-21244) + 1:50 SiglecF-Alexa Fluor 488 (BD ...
-
bioRxiv - Molecular Biology 2023Quote: ... hUHRF1-TTD-mut) and 12 micrograms of dsRed-tagged plasmid (DNMT3A, DNMT3B) were transfected using 60 µL Lipofectamine 2000 (Thermo Fisher Scientific). After a 3-hour incubation with Lipofectamine ...
-
bioRxiv - Molecular Biology 2023Quote: ... The mCherry tagged SETD6 WT or Y285A and EGFP-tagged E2F1 WT or K117R were co-transfected into HEK293 cells using polyethyleneimine (Thermo Fisher Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... the cells were transfected with 1μg/well of the HA-tagged Fpn plasmid (Vector Builder, VB220407-1185gaa, Supplemental Figure 1) using Lipofectamine™ 3000 Transfection Reagent (Invitrogen, L3000001).
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then again incubated with p65 primary antibody (1:1000) overnight and successively incubated with secondary antibody tagged with Alexa Fluor IgG 555 (#A32732, Thermo Fisher Scientific) as per abovementioned protocol ...
-
bioRxiv - Immunology 2023Quote: ... the C-terminal FLAG-tagged WT sCTLA-4 and Y139A sCTLA-4 in pCMV-Tag4A were sub- cloned into the pFastBac vector (Thermo Fisher Scientific) to generate pFastBac-WT_sCTLA- 4-FLAG and pFastBac-Y139A_sCTLA-4-FLAG.
-
bioRxiv - Molecular Biology 2023Quote: ... the brain sections were washed for 5 min x3 in 0.1% Tween 20/PBS and incubated in fluorescence tagged secondary antibodies for 2 hours at RT: Alexa Fluor 594 anti-rabbit (1:500, ThermoFisher Scientific, A11037), Alexa Fluor 488 anti-mouse IgG1 (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... Slides were rinsed twice with PBS and incubated in freshly prepared Alexa Fluor 488-tagged IB4 (Invitrogen, 10μg/mL in 1mM CaCl2) for 10 minutes ...
-
bioRxiv - Systems Biology 2023Quote: ... ABE8e was expressed as an 8xHis tagged protein from a rhamnose-inducible promoter in BL21-Star DE3 cells with low RNase activity (Thermo Fisher Scientific). At an OD600 of ∼0.8 ...
-
bioRxiv - Cancer Biology 2023Quote: ... followed by 2 h incubation at RT with anti-mouse HRP tagged secondary antibody for p53 and anti-rabbit for OC (ThermoFisher Scientific, USA) with 1:10000 dilution ...
-
bioRxiv - Molecular Biology 2023Quote: ... brain slices were washed 3X in 1X TBS and then incubated for 2 hours at RT with a fluorescent-tagged Alexa Fluor 568 anti-mouse secondary antibody (1:500; Life Technologies A11004). Brain sections were then washed 3X in 1X TBS ...
-
bioRxiv - Biophysics 2024Quote: RBL-2H3 cells stably expressing clathrin light chain A tagged with green fluorescent proteins were cultured in minimum essential medium (MEM) (Invitrogen 11095-09) with 20% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2024Quote: ... 1X FLAG (DYKDDDDK)-tagged CLCC1, TMEM41B (DNASU, HsCD00829148), and VMP1 (DNASU, HsCD00080545) were cloned using the Gibson assembly and the Gateway system (Thermo Fisher, 11791020) in a pLenti-CMV-Hygro vector (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: Plasmids expressing GST-tagged Spt6p were produced by inserting the Spt6p(1223-1451) coding sequence into the pDEST15 vector (Thermo Fisher Scientific). Mutations in the tSH2 domain were introduced using site-directed mutagenesis (Sdano et al ...
-
bioRxiv - Cancer Biology 2021Quote: ... the same protocol as above was used except cells were treated with the following antagonists which were directly added to the conditioned media: AZD4547 (FGF receptor, Fisher Scientific #NC0660421, 100 ng/ml) or DMH1 (BMP receptor ...
-
bioRxiv - Cancer Biology 2022Quote: ... was used for gene expression analysis of known estrogen receptor target genes using a QuantStudio™ 3 Real-Time PCR System (Applied Biosystems™, CAT: A28567). All primers were purchased from Integrated DNA Technologies ...
-
bioRxiv - Plant Biology 2019Quote: ... pEF1-MCS-3Myc [BamHI-NotI-3Myc-stop fragment was inserted between KpnI and XbaI sites of pEF1/myc-His B vector (Invitrogen)] was generated ...
-
bioRxiv - Microbiology 2020Quote: The parB genes were recombined into a Gateway-compatible destination vector pET-His-MBP-TEV-DEST 56 via an LR recombination reaction (ThermoFisher). For LR recombination reactions ...
-
bioRxiv - Developmental Biology 2021Quote: ... was modified by replacement of the SV40 promoter by the Drosophila actin promoter from the pAct5.1/V5-His C vector (Thermo Scientific), and the firefly luciferase coding sequence by the Renilla luciferase (RLuc ...
-
bioRxiv - Neuroscience 2022Quote: Genes encoding the full-length sequences of Human PP2A A subunit and PP2A C subunit with N-terminal His tag and non-cleavable HA tag were sub-cloned into the pFastBac-Dual vector (Invitrogen). Sequences of PP2A A and C subunits are shown in Table 1 ...
-
bioRxiv - Microbiology 2022Quote: ... The two pAcgp67-RBD (residues 333–530) plasmid with a C-terminal 8×His tag were transfected into Sf9 cells using Cellfectin II Reagent (Invitrogen) to produce the recombinant baculoviruses ...
-
bioRxiv - Immunology 2022Quote: Recombinant soluble ICAM-1 protein was expressed in a Drosophila Melanogaster cells using pMT/V5-His vector with inducible promotor (Invitrogen), purified by sequential two-step affinity chromatography on anti-ICAM-1 antibody (clone YN1.1 ...
-
bioRxiv - Immunology 2021Quote: ... The efficiency of the expression and purification of recombinant proteins were evaluated by 12% SDS-PAGE and Western blotting by using anti-his tag antibodies (1:3,000) (Thermo Scientific) and HRP-conjugated goat anti-mouse IgG (1:10,000 ...
-
bioRxiv - Cell Biology 2019Quote: ... The resulting PCR product was cloned between 5’ KpnI and 3’ EcoRI sites of the pMT/V5-His vector (Invitrogen). In-frame Tag-RFP-T gene was then introduced at the 3’ end of γ-tubulin gene between 5’ EcoRI and 3’ NotI sites ...
-
bioRxiv - Cell Biology 2019Quote: ... The resulting PCR product was then inserted into the 5’ SpeI and 3’ EcoRI sites of the pMT/V5 His-B vector (Invitrogen) containing in-frame mTurquoise2 gene at the 5’ end ...
-
bioRxiv - Biochemistry 2019Quote: ... the polynucleotides encoding GtACR1 mutants were fused in frame with a C-terminal eight-His tag and subcloned into the pPIC9K vector (Invitrogen) between EcoRI and NotI sites ...
-
bioRxiv - Bioengineering 2019Quote: ... precipitate and soluble of was checked for the expression by SDS-PAGE and confirmed indirectly by Western blot with anti-his antibody (Invitrogen).
-
bioRxiv - Synthetic Biology 2019Quote: ... An anti-6His antibody (6x-His Tag Polyclonal Antibody) and an anti-HA antibody (HA Tag Polyclonal Antibody) were purchased from Invitrogen. Western blot analysis was conducted as described previously 45.
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... The BglII and EcoRI restriction sites were used to insert the sequence into the pMT/BIP/V5-His plasmid (ThermoFisher). The production of recombinant IrSPI protein was performed by the Recombinant Proteins in Eukaryotic Cells Platform ...
-
bioRxiv - Molecular Biology 2019Quote: ... Emulsion PCR was performed using the Ion PGM Hi-Q View OT2 Kit and the Ion OneTouch 2 system (ThermoFisher). Template-positive ion sphere particles (ISPs ...
-
bioRxiv - Molecular Biology 2019Quote: ... Enriched ISPs were loaded on a PGM 314R v2 chip and sequenced using the Ion PGM Hi-Q View Sequencing Reagents (ThermoFisher). Raw sequencing data were processed using the Torrent Suite software v5.0 (ThermoFisher) ...
-
bioRxiv - Genomics 2021Quote: ... TaTLP2-B gene was re-amplified from the confirmed clone using the same primers and ligated into the pYES2.1/V5-His-Topo vector (Invitrogen, USA). The recombinant plasmid (pYES2.1-TaTLP2-B ...
-
bioRxiv - Immunology 2021Quote: ... each mouse Siglec gene containing 2-3 domains with pairs of forward and reverse primers (Table S5) were cloned into pcDNA5/FRT/V5-His-TOPO vector (Invitrogen), which contained a C-terminal hIgG1-Fc ...
-
bioRxiv - Microbiology 2021Quote: ... with a N-terminal gp67 signal peptide for secretion and a C-terminal 6×His tag for purification was inserted into pFastBac-Dual vector (Invitrogen). The recombinant baculoviruses were generated according to the manufacture’s instruction to infect Hi5 cells at a density of 2×106 cells/ml ...
-
bioRxiv - Biophysics 2021Quote: The bacteriophage T7 gp15 gene was inserted into the pRSET-B vector (ampr and 6x-His tag) from Invitrogen (USA), between the XhoI and EcoRI restriction sites ...
-
bioRxiv - Biochemistry 2020Quote: ... the opsin-encoding constructs were fused in frame with a C-terminal eight-His tag and subcloned into the pPIC9K vector (Invitrogen). Mutants were generated with Quikchange XL kit (Agilent Technologies ...
-
bioRxiv - Biochemistry 2020Quote: ... with a N-terminal 8x His tag was expressed from the pSJ2 vector (84) in BL21 E.coli and purified by Ni-NTA resin (Thermo Fisher). Full-length human Src kinase (WT or K298M ...
-
bioRxiv - Neuroscience 2020Quote: ... for 48 h then transfected for 24 h with 1 ug His-G3BP1 3’UTR constructs using Lipofectamine LTX and Plus reagent (Invitrogen). To determine mRNA stability ...
-
bioRxiv - Cancer Biology 2021Quote: ... Biotinylated RNA baits were used in a ratio 1:12 to Hi-C libraries (25 ng biotinylated RNA baits per 300 ng of Hi-C library) and supplemented with 30 units SUPERase-In (Ambion). Biotinylated RNA baits for capture DNA-Seq were used in a ratio of 1:3.33 (300 ng RNA baits per 1,000 ng genomic DNA library ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 ml of Dynal sheep-anti mouse IgG paramagnetic beads were non-covalently coupled with 60 µg of anti-His mAb (Invitrogen) in PBS plus 0.1% immunoglobulin-free BSA (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... M-OPG2 and S-OPG2 were generated by inserting the respective cDNAs in frame between NheI and AflII sites of a pcDNA5/FRT/V5-His vector (Invitrogen) containing a C-terminal OPG2 tag (MNGTEGPNFYVPFSNKTG) ...
-
bioRxiv - Cell Biology 2021Quote: qPCR analysis was performed using the LabTaq Green Hi Rox (Labtech) following manufacturer’s instructions on a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems) and primers listed in Supplementary Table S4.
-
bioRxiv - Plant Biology 2021Quote: ... fused with a six-HIS tag at the C-terminus were expressed using the Bac-to-Bac baculovirus expression system (Invitrogen) in High Five cells at 22 °C as reported previously 23 ...
-
bioRxiv - Microbiology 2021Quote: ... Amplified fragments were digested with KpnI and XhoI and cloned into the pre-cut pcDNA4/myc-His A vector (Invitrogen) by using the DNA ligation Kit (Takara) ...
-
bioRxiv - Microbiology 2019Quote: ... the sequence coding for vpa0226 was amplified using primers 5’ GATCCTGCAGATGCTTAAAATTAAACTGCCT 3’ and 5’ GATA GAATTCTTACTTATCGTCGTCATCCTTGTAATC 3’ and then cloned into the pBAD/Myc-His vector (Invitrogen, resistance changed from ampicillin to kanamycin ...
-
bioRxiv - Molecular Biology 2022Quote: ... with FLAG sequence flanking at 5’ end of the primer and cloned in Hind III and Xba I site of pCDNA3.1V5-His (Invitrogen, USA). Clones were sequenced with T7 and BGH primer using ABI BigDyeTerminator V3.1 cycle sequencing kit followed by automated sequencing in ABI 3130 Genetic Analyzer according to manufacturer’s protocol.