Labshake search
Citations for Thermo Fisher :
2951 - 3000 of 10000+ citations for 8 Chloro 2 3 4 5 tetrahydropyrido 3 2 f 1 4 oxazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: Binucleation analyses and detection of aberrant divisions were performed by heat-fixing cells on a microscope slide at 70 °C before staining with 4’,6-diamidino-2-phenylindole (DAPI) (SlowFade Diamond Antifade Mountant with DAPI, Invitrogen) and Calcofluor (Sigma) ...
-
Beclin1-Deficient Adipocytes Promote Tumor Progression by YAP/TAZ-dependent Adipocyte TransformationbioRxiv - Biochemistry 2023Quote: ... Colony formation assays were performed by mixing various numbers of differentiated adipocytes (incubated for 2 days in differentiation media and then 4 days with DMEM (Gibco), 1 μM insulin (I9278 ...
-
bioRxiv - Bioengineering 2023Quote: PAAm gels prepared on coverslips were transferred to multiwell plates before covering with 0.2 mg/mL sulfosuccinimidyl 6-(4’-azido-2’-nitrophenylamino)hexanoate (sulfo-SANPAH) (Thermo Fisher) solution ...
-
bioRxiv - Genetics 2023Quote: ... Protein was separated on a 4–12% Bis-Tris gel and transferred using iBlot 2 transfer apparatus (Thermo Fisher Scientific). A 5% milk solution in TBST was used for blocking for 1 hour at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... and 10% 2-Mercaptoethanol or 50 mM dithiothreitol (DTT) and run on NuPAGE 4-12% bis-tris gels (Thermo Fisher). Proteins were transferred to nitrocellulose membranes ...
-
bioRxiv - Cell Biology 2024Quote: ... a working solution of 0.83 mg/mL solution of sulfosuccinimidyl 6-(4′-azido-2′-nitrophenylamino)hexanoate (sulfo-SANPAH, 22589; Thermo Fisher) in PBS was prepared from a stock solution of 83 mg/mL sulfo-SANPAH in DMSO (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2023Quote: ... intracellular staining was performed for 2 h at 4°C after stimulation for 2 h with PMA/Ionomycin Cell Stimulation Cocktail containing protein transport inhibitors (ThermoFisher). Data were acquired on an Aurora (Cytek Biosciences ...
-
bioRxiv - Cell Biology 2023Quote: ... The reactions were quenched with 2 μl of 2.7 M ammonium bicarbonate before loading on Bolt™ 4–12% Bis-Tris Plus gels (Invitrogen) for separation ...
-
bioRxiv - Genetics 2024Quote: ... HEK293T cells cultured in 15-cm Petri dishes were grown to 60-70% confluency and then transfected with 4 µg of the UTR library of DNA templates (2 µg for each UTR library) using lipofectamine 3000 reagent (Invitrogen). Fourteen hours after transfection ...
-
bioRxiv - Physiology 2024Quote: ... CHX-treated cells were harvested at different time points (0, 2, 4 and 6 hours) and processed for immunoblotting with anti-LSD1 (Invitrogen) and anti-RCOR1 (Abcam ...
-
bioRxiv - Cancer Biology 2024Quote: ... and A-253 cells were serially diluted and seeded at three different dilutions (2, 4 and 128 cells/well) with 50 µL serum-free DMEM/F12 medium (Gibco) supplemented with 10 ng/ml human EGF (R & D systems) ...
-
bioRxiv - Biophysics 2024Quote: ... This was done by placing 0.2 mg/ml sulfo-succinimidyl-6-(4-azido-2-nitrophenyl-amino) hexanoate (sulfo-SANPAH) (Thermo Fisher) in 0.5 mM pH 8.5 HEPES buffer onto the hydrogel surface and irradiating with ultraviolet (UV ...
-
bioRxiv - Bioengineering 2024Quote: ... the sections were rinsed in PBS and the nuclei were counterstained and mounted with Slowfade gold antifade mountant containing 4’,6-diamidino-2-phenylindole (DAPI; #S36939, Invitrogen). The slides were imaged at a 4X magnification using EVOS M7000 (ThermoFisher Scientific™ ...
-
bioRxiv - Immunology 2024Quote: ... filtered through a 0.45 µm pore-sized filter to remove cell debris and concentrated by centrifugation at 100000 g for 2 h at 4°C (Thermofisher WX Ultra80 centrifuge ...
-
bioRxiv - Molecular Biology 2024Quote: ... 25 μg of protein (or all of the sample for the MDF multiplexing experiment across 2 gels) was loaded into a NuPAGE 4∼12% Bis-Tris 1.5 mm gel (Invitrogen #NP0335) and gel electrophoresis performed ...
-
bioRxiv - Neuroscience 2024Quote: ... microglia were plated on 25 mm coverslips coated with PLL (0.01%) and Collagen IV (4 µg/ml) and loaded with 10 µM Fura-2 AM (Thermo Fisher) with 0.02% Pluronic F-127 (Thermo Fisher ...
-
bioRxiv - Microbiology 2024Quote: ... Transfectants were selected with either 4 nM WR99210 (Jacobus Pharmaceuticals; pSLI) or 2 μg/μl blasticidin S (Life Technologies; pSLI2). SLI for selection of parasites with the plasmid integrated into the genome was done as described (Birnbaum et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... only 4 μL of 1 mM FM 4-64 (Cat. number T13320, Thermo Fisher, Waltham, MA) was injected ...
-
bioRxiv - Neuroscience 2024Quote: ... Neurons were incubated in HBS with 4 μM Fura Red and 0.04% Pluronic® F-127 (Invitrogen #P3000MP) for 30 min at 37℃ ...
-
bioRxiv - Neuroscience 2020Quote: ... claudin-5 (1 μg/ml) and occludin (2 μg/ml; all from Thermo Fisher Scientific). After incubation with primary antibodies membrane was washed with PBS-T three times on a platform rocker and incubated with horseradish peroxidase-conjugated secondary antibody diluted in PBS-T 1:2000 (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Recovered nuclei were stained with FITC-conujugated α-5-bromo-2’-deoxyurine (Invitrogen, MoBu-1) in staining buffer (2 mM HEPES pH 7.4 ...
-
bioRxiv - Developmental Biology 2023Quote: Tadpoles were immersed in a solution containing 1 mM EdU (5-ethynyl-2’-deoxyuridine; Invitrogen) before fixation ...
-
bioRxiv - Immunology 2021Quote: ... on the QuantStudio 5 or QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific). Relative transcript levels were normalized to TATA-binding protein (Tbp ...
-
bioRxiv - Genomics 2020Quote: ... or a positive control probe 5’-5Alexa488N/(ATA)8TUU (ATA)7-3’ (Invitrogen). Reactions were incubated in a water bath at 37°C for 2 hrs ...
-
bioRxiv - Cancer Biology 2020Quote: Non-targeting control (CTRL) (Dharmacon) 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion ...
-
bioRxiv - Bioengineering 2021Quote: ... or siRNA targeting CTNNB1 (siCTNNB1, targeting sequence 5′- CCACAGCUCCUUCUCUGAGUGGUAA -3’, ThermoFisher, Waltham, MA) were resuspended in 50 μL of Opti-MEM and incubated at room temperature for 30 min ...
-
bioRxiv - Developmental Biology 2019Quote: ... with 3 M Na-Acetate and linear polyacrylamide (5 mg/mL, Ambion®) overnight at −80°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3′-end fluorescent labeling of the RNAs with fluorescein-5-thiosemicarbazide (ThermoFisher Scientific) was done as previously reported (Grozdanov and Stocco ...
-
bioRxiv - Microbiology 2020Quote: ... 3 to 5 colonies were transferred in Mueller-Hinton broth (Thermo Scientific Oxoid) and adjusted to an optical density at 600nm (OD ...
-
bioRxiv - Immunology 2020Quote: Pieces of 3 mm3 tumors were submerged in 5 vol of RNAlater (Invitrogen) (n = 5 samples/group) ...
-
bioRxiv - Developmental Biology 2020Quote: 3 × 106 ESC cells were distributed to 5 12-well dishes (Thermo Scientific) with 5 × 105 mESC cells per well ...
-
bioRxiv - Immunology 2022Quote: ... 5 μl RNA (2ng/μg) and 3 μl of 5x Primer stock (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Amplifications were run on a QuantStudio 3 or 5 thermal cycler (Thermo Fisher) and results were analyzed using the instrument software ...
-
bioRxiv - Cell Biology 2023Quote: ... vector encoding a sgRNA targeting PAC (5′-TGTCGAGCCCGACGCGCGTG-3′) using Lipofectamine 2000 (Invitrogen). GFP positive cells were isolated by FACS two days after infection ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were passaged every 3-5 days using Accutase or ReleSR (ThermoFisher Scientific).
-
bioRxiv - Cancer Biology 2023Quote: 5’ and 3’ RACE was performed using the GeneRacer kit (Thermo Fisher Scientific), following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... 200 nM MCPH1-5’-CUCUCUGUGUGAAGCACCUdTdT-3’) in serum-Free Opti-MEM medium (Gibco). The transfection controls were set up as above but without adding the siRNA oligos ...
-
bioRxiv - Microbiology 2020Quote: ... epidermidis (Thermo scientific; 3 μg/ ml in 1% BSA). MSC’s were labelled with anti-vimentin monoclonal antibody (Sigma ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1.1ul (4U) FastDigest-HindIII (prediluted 1/3) (Thermo Fisher) and 11.1ul 20X primer-probe mix ...
-
bioRxiv - Biophysics 2021Quote: ... Mirius (1:3) in Opti-MEM media (Thermo scientific). Cell confluency was allowed to reach 70-80% prior to transfection ...
-
bioRxiv - Bioengineering 2021Quote: ... or rabbit anti-caspase-3 (1:500, ThermoFisher #700182) followed by Alexa-conjugated anti-mouse or anti-rabbit secondary antibodies for 8 hours each at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... or (3) 1:20 AlexaFluor 647 phalloidin (ThermoFisher #A22287) (Figure S2F ...
-
bioRxiv - Cell Biology 2021Quote: ... in a 1:3 ratio using lipofectamine (Life Technologies) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... in a 1:3 ratio using lipofectamine (Life Technologies) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... PBS containing 1 µM TO-PRO 3 (Thermo Scientific) was applied to each section followed by 3 washes with PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... with TO-PRO-3 (#T3605, ThermoFisher, 1:1000 dilution).
-
bioRxiv - Neuroscience 2021Quote: ... 1-hexanol (99%, ACROS Organics, CAS 111-27-3), 2-oxovaleric acid (>98% ...
-
bioRxiv - Microbiology 2021Quote: ... 3-cholamidopropyl dimethylammonio 1-propanesulfonate (CHAPS; zwitterionic; Thermo Scientific). In addition ...
-
bioRxiv - Developmental Biology 2022Quote: IF blocking buffer: 1/3 Blocker Casein (ThermoFisher 37528), 2/3 HEPM with 0.05% Triton X-100
-
bioRxiv - Molecular Biology 2021Quote: ... containing 1 M sodium chloride (S671-3, Fisher Scientific). The labelling protocol was carried out at pH 7.5 ...