Labshake search
Citations for Thermo Fisher :
2951 - 3000 of 10000+ citations for 2' 3' cGAMP STING based FRET Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... was added using the primers 5’ GACCGTCTCGAGAAAAGAAAAGTCTTTGGACGATGTGAGC and 3’ GTGACTGAATTCTTACTAATGGTGATGGTGGTGATGGCCGCTCAGCCGGCAGCCTCTGA TCCAC and the product was subsequently cloned into the vector pPIC9K (Invitrogen) between the Xho I and EcoR I sites by doing a three-way ligation (EcoR I ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were washed at least 5 times 20 min and transferred to 0.25% PBT with 1:400 TO-PRO-3 (ThermoFisher #T3605) for 2 nights ...
-
bioRxiv - Cancer Biology 2021Quote: ... Slides were washed with 1X PBS 3 times for 5 minutes and then mounted with Prolong Glass Antifade mountant (Invitrogen). Confocal Z-stack images were acquired using Nikon SoRA spinning disk microscope ...
-
bioRxiv - Cell Biology 2021Quote: ... sections were washed at least 3-5 times with TBSTX buffer and incubated with the appropriate Alexa fluorescent secondary antibodies (Invitrogen). Sections were washed 3-5 times with TBSTX buffer and then mounted on Superfrost slides (Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were pelleted down at 2,500 rpm for 3 mins and were washed 5 times with ice-cold DPBS (Gibco #14200075). The pellets were finally dissolved in DPBS and were counted by haemocytometer using Trypan Blue stain (Gibco #15250061) ...
-
bioRxiv - Immunology 2021Quote: ... forward 5’-TAACCGGTATGGGCATACTGAGCTTTCT-3’ (contains the AgeI restriction site) and reverse 5’-TAGGATCCAATCCTGTTCTGGTCGTCG-3’ (contains the BamHI restriction site) and the PCR product was cloned into pCRBlunt (Invitrogen) and sequenced ...
-
bioRxiv - Biophysics 2021Quote: ... we wash the blot 3 times with TBST and soak for 5 min in chemiluminescent substrate (Thermo Scientific catalog # 34080).
-
bioRxiv - Plant Biology 2021Quote: ... ISR1 CDS with a 5’ EcoRI restriction site and 3’ BamHI restriction site was amplified using Phusion (Thermo Fisher Scientific) and ISR1 start + EcoRI FOR and ISR1 no stop + BamHI REV primers (Table S1) ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were then washed 3 × (MBL2 wash buffer) and stained with DAPI (600 nM in MBL2 wash buffer; 5 min, RT; ThermoFisher) before imaging ...
-
bioRxiv - Cell Biology 2021Quote: ... so that 50 μg of total protein could be mixed with 5% Coomassie brilliant blue G-250 before loading on a 3-12% Bis-Tris BNE gel (Invitrogen). After electrophoresis (2.5 hr ...
-
bioRxiv - Cell Biology 2020Quote: ... slides were washed 3 times in PBST for 5 minutes each and mounted using ProLong Diamond Antifade Mountant (Invitrogen, P3696). Coverslips were carefully placed over the sections ...
-
bioRxiv - Bioengineering 2022Quote: ... cells were washed 3 x 5 min with PBS before adding secondary antibody (1:200 Alexafluor-488 goat anti-mouse, Invitrogen) and rhodamine phalloidin (1:100 ...
-
bioRxiv - Molecular Biology 2022Quote: ... NC) or plasmid with HAX1 gene with tag on 3’end or 5’end of the gene (LipofectamineTM2000, ThermoFisher Scientific). Cells were detached and seeded on 100mm plates to grow single colonies (selection ...
-
bioRxiv - Neuroscience 2022Quote: ... Coverslips were rinsed 3 times for 5 minute intervals with PBS and mounted on microscope slides (Fisher Scientific, 22-178277) using ProLong Glass Antifade Mountant (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... F 5’-GAACTGTCCAGATGCCCTTCCAGTT-3’ and R 5’-GCATCTGGACAGTTCTGGGAAGCCCG-3’) was cloned by PCR and ligated into the pEF6/V5-His TOPO plasmid vector (Invitrogen). FBLN7-V5-His vector was transfected into CHO cells (FBLN7-CHO ...
-
bioRxiv - Immunology 2022Quote: ... complementary DNA (cDNA) was generated from extracted mouse plasma RNA using primer YB383 5’-TTTTTTTTTTTTTTTTTTTTTTTTRAAGCAC-3’ and enzyme Superscript III (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were again washed 3× in PBS for 5 min each and mounted onto slides using ProLong Gold Antifade (Invitrogen). Images of stained mTECs were obtained using an SP8 (Leica Microsystems ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were dried for 30 mins in a 37°C incubator and washed 3×5 min with 0.1% TritonX-100 in PBS (PBST) and incubated in 10% Horse Serum (ThermoFisher, #26050070), 0.4% TritonX-100 in 1x PBS (blocking buffer ...
-
bioRxiv - Plant Biology 2022Quote: ... Rosettes were rinse 3 times in distilled water and stained 20 min in a 5% (v/v) Lugol’s iodine solution (Fisher Scientific). After 3 rinses in distilled water ...
-
bioRxiv - Neuroscience 2021Quote: ... Following secondary antibody incubation samples were washed 3 times for 5 minutes with PBS and then mounted on glass slides in ProLong Glass Antifade Mountant (P36984, Invitrogen) with a #1 coverslip ...
-
bioRxiv - Neuroscience 2021Quote: ... Then slides were washed 3×5’ in TBS and incubated in donkey-α-sheep-488 (1:500, Life Technologies, A11015) in TBS for 90’ ...
-
bioRxiv - Immunology 2021Quote: ... 4 million splenocytes cells were stimulated ex vivo for 3 hours at 5% CO2 at 37°C in Minimum Essential Media (Gibco) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and reverse (5’-ACAGGACATTGACCAACCCA-3’) primers (0.3μM) and 1X premixed Phusion Flash High-Fidelity PCR Master Mix (Thermo Scientific, France). Amplifications were carried out in a thermal cycler LifeEco (BIOER Technology ...
-
bioRxiv - Genetics 2022Quote: ... Hygromycin-resistant colonies emerging on the surface of the overlay after 3–5 days were excised and transferred to MEA amended with 100 µg/mL of hygromycin B (Invitrogen) (MEA+Hyg100) ...
-
bioRxiv - Genetics 2022Quote: The cloned SNP STARRseq library (100ug plasmid DNA/replica) was transiently transfected into LNCaP cells (5 × 107 cells/replica; 3 biological replicas) using the Neon Transfection System (Invitrogen). Cells were grown in RPMI 1640 medium supplemented with 10% FBS and collected 48hrs post electroporation ...
-
bioRxiv - Biochemistry 2022Quote: ... Wild type wis1+ open reading frame or versions in which Methionine at 395 was substituted with alanine or glycine were synthesised by integrated DNA technologies (IDT) with PstI site at 5’end and KpnI site at 3’end and cloned into pJet1.2 (Thermo Scientific). Wild type wis1+ ORF was amplified by Phusion PCR from NT4 genomic DNA with primers containing PstI and KpnI restriction sites at 5’ end and 3’ end respectively ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were transfected with scrambled small interfering RNA or small interfering RNA (siRNA) to silence TMX4 expression (5′-GCAUGGUGUUCUUACGUUUtt-3′, 100 nM per dish, Silencer Select Pre-designed, Ambion). Cells were processed for immunofluorescence or for biochemical analyses after 48h of transfection.
-
bioRxiv - Physiology 2022Quote: ... then perfused the lungs with 3 mL of ice-cold DPBS containing Ca2+ and Mg2+ followed by 5 mL of 4% methanol-free formaldehyde (ThermoFisher) in DPBS containing Ca2+ and Mg2+ ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 3 to 5 min at 37°C and resuspended in differentiation medium N2B27 (Advanced DMEM F12, Neurobasal vol:vol (Life Technologies)) ...
-
bioRxiv - Neuroscience 2019Quote: ... and then transfected with 2.5 µg of donor DNA and 1.25 µg of each targeting construct (Supplemental Table 3) using Lipofectamine Stem (Invitrogen STEM00003) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... Beads were then washed with ice-cold lysis buffer 3 times for 5 minutes and proteins were recovered by boiling in denaturing loading buffer (Invitrogen).
-
bioRxiv - Microbiology 2020Quote: ... 100 ng of extracted vRNAs were reverse transcribed using a Uni-12 primer (5’-AGCRAAAGCAGG-3’) and Superscript III reverse transcriptase (Invitrogen). Quantification was performed by qPCR on a Rotor-Gene Q 2plex System (Qiagen ...
-
bioRxiv - Immunology 2020Quote: ... centrifuged at 300g for 5 min and resuspended in 3 mL of 1X ebioscience Red Blood Cell Lysis Buffer (ThermoFisher) for 5 min at 37°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... Slides were then washed with PBS-T (3 × 5 min) and incubated with fluorophore-conjugated secondary antibodies (1:500 in blocking buffer, Invitrogen). Hoechst 33258 (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was synthesized using the env V1/V3 Primer ID primer (HXB2 positions 6585-7208): 5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNNNNNCAGTCCATTTTGCT CTACTAATGTTACAATGTGC-3’ and SuperScript III Reverse Transcriptase (Invitrogen). The final cDNA reaction contained the following ...
-
bioRxiv - Genomics 2021Quote: ... 10 µg of antibody (3 µg for H3K27ac) was added to 5 µg of sonicated chromatin along with Dynabeads Protein A magnetic beads (Invitrogen) and incubated at 4 °C overnight ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were centrifuged for 3 mins at 300 x g and resuspended in 5 mL of 5x TrypLE (Cat.No. A1217701; Thermo Fisher) in L15 and incubated on an orbital rotator at room temperature for 15 min ...
-
bioRxiv - Immunology 2021Quote: ... 4 million cells per sample were stimulated ex vivo for 3 hours at 5% CO2 at 37°C in Minimum Essential Media (Gibco) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Cancer Biology 2020Quote: ... HGrC1 cells (15 samples including 3 replicates for 5 conditions) were lysed using TRIzol reagent (catalog #15596026, Thermo Fisher Scientific) and RNA was extracted with Direct-zol RNA MiniPrep kit (#R2052 ...
-
bioRxiv - Immunology 2021Quote: ... 4 million isolated splenocytes or inguinal lymph node cells were stimulated ex vivo for 3 hours at 5% CO2 at 37°C in Minimum Essential Media (Gibco) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2021Quote: ... Qβ-VLPs were then re-packaged with B-type 1668 CpGs (5″-TCC ATG ACG TTC CTG ATG CT-3″) with phosphorothioate backbone purchased from (InvitroGen). The re-packaging was confirmed by 1% agarose gel stained with SYBR Safe dye for 30min at 90V ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μL (10μM) reverse primer (ldh4_R, 5’-AATCACAGCAGCCCCTTG-3’) and 1 μL (1 U/μL) Platinum Taq DNA polymerase (Invitrogen, 10966-018) in a 50 μL total reaction volume ...
-
bioRxiv - Developmental Biology 2022Quote: ... 10 µg of antibody (3 µg for H3K27ac) was added to 5 µg of sonicated chromatin along with Dynabeads Protein A magnetic beads (Invitrogen) and incubated at 4 °C overnight ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were then washed 3 times for 5 minutes each with PBS and mounted using ProLong Diamond anti-fade mountant with DAPI (Invitrogen) and allowed to cure overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... 5′-CCUGGAUAAUGAUGAAGGA-3′), OSBP (predesigned, cat. no. 4392420) and nontargeting control siRNA (predesigned, cat. no. 4390844) were purchased from Ambion. ON-TARGET plus Human PI4K2A siRNA (predesigned ...
-
bioRxiv - Cell Biology 2022Quote: ... All samples were boiled for 5 min prior to separation by SDS PAGE on precast 3-8% Tris-Acetate NuPAGE gels (Invitrogen). SDS-PAGE fractionated proteins were transferred to a nitrocellulose membrane using a semidry Trans-Blot Turbo Transfer System (Bio-rad) ...
-
bioRxiv - Immunology 2022Quote: ... 5-7 × 106 cells were resuspended in 3 mL of FACS buffer (4% FBS in phosphate buffered saline (PBS, Gibco)) and sorted at the University of Massachusetts Amherst Flow Cytometry Core Facility using a BD FACSAria Fusion (Becton Dickinson) ...
-
bioRxiv - Physiology 2022Quote: ... R:3’-UUGAACGUCACUAUAUUAACUGUUGUA-5’) dicer-substrate siRNA (DsiRNA) (20 nM, Integrated DNA Technologies, Coralville, IA) using Lipofectamine 3000 transfection reagent (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were then washed 3× for 5 min each in PB and mounted with Prolong Gold (Thermo Fisher cat#P36930) and Deckglaser cover glass (Fisher Scientific cat#NC1776158) ...
-
bioRxiv - Bioengineering 2023Quote: ... The fixed cells were then washed with 0.1% Triton X-100 in PBS solution for 3 times with 5 min each and incubated with Goat anti-rabbit 488 nm (Thermofisher Scientific Cat# A-11008 ...