Labshake search
Citations for Thermo Fisher :
251 - 300 of 10000+ citations for Recombinant Human Low Density Lipoprotein Receptor Related Protein 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... and 2 ng/ml recombinant human FGF-Basic (Thermo Fisher Scientific) in a humidified incubator with 5% CO2 at 37°C ...
-
bioRxiv - Microbiology 2020Quote: Recombinant human mAbs were expressed in Expi293 HEK cells (Life Technologies), which were maintained in suspension at 37°C and 8% CO2 ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant human (h) PF4 was expressed in Drosophila Expression System (Invitrogen) S2 cells and purified as described22 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 50 ng/mL recombinant human EGF (Thermo Fisher Scientific, Waltham, MA), 0.1 mM N-acetyl-L-cysteine (Sigma ...
-
bioRxiv - Cell Biology 2019Quote: Purified recombinant human p38α (MAPK14, GST-tagged, Thermo Fisher Scientific, #PV3304), p38β (MAPK11 ...
-
bioRxiv - Neuroscience 2021Quote: ... and 20 ng/mL thermostable recombinant human Fibroblast Growth Factor (Gibco)] unless otherwise noted ...
-
bioRxiv - Immunology 2021Quote: ... with 17 ng/ml of recombinant human IL-2 (ThermoFisher Scientific). MART-1-specific CD8+ T-cell clones were generated by Friedmann et al (Friedmann et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... the recombinant GST-tagged kinase active human mTOR (Cat. PV4753, ThermoFisher) was used instead of the immunoprecitated mTORC1 ...
-
bioRxiv - Genetics 2022Quote: ... Recombinant human macrophage colony-stimulating factor (CSF1, Gibco-Thermo Fisher, PHC9501) was then added at a final concentration of 100 ng/ml ...
-
bioRxiv - Developmental Biology 2023Quote: ... 50 ng/ml recombinant human epidermal growth factor (Invitrogen, Waltham, MA), and 5 μg/ml of follicle-stimulating hormone (Bioniche Animal Health ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 ng/ml human recombinant epidermal growth factor (Fisher Scientific PHG0311), 5 mM glucose (Fisher Scientific A2494001) ...
-
bioRxiv - Genetics 2022Quote: ... Recombinant human macrophage colony-stimulating factor (CSF1, Gibco-Thermo Fisher, PHC9501) was then added at a final concentration of 100 ng/ml ...
-
bioRxiv - Microbiology 2024Quote: ... Treatment with recombinant 10 U/mL human IFNγ (ThermoFisher Scientific RIFNG100) was done at 24 hours post-infection ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Human V1A Receptor-CHO cell line (CHO -V1a) was cultured in Ham’s F12 (Life Technologies) supplemented with 10% fetal bovine serum (Life Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... The cells were stained with human FITC conjugated transferrin receptor (CD71; ThermoFisher: 11-0719-42) and human FITC conjugated glycophorin A (CD235a ...
-
bioRxiv - Microbiology 2023Quote: ... Recombinant proteins were quantified with Pierce™ BCA Protein Assay Kit (Life Technologies) and the purity of the purified proteins was checked by SDS-PAGE and western blot using anti-His antibody (1:1000 ...
-
bioRxiv - Neuroscience 2019Quote: ... Briefly recombinant Protein G Agarose beads (ThermoFisher cat# 15920010) were washed three times with PBS ...
-
bioRxiv - Microbiology 2021Quote: ... 25 µL packed Recombinant Protein A-Sepharose 4B (Invitrogen) was used to capture the immune complexes for 1 hour at RT ...
-
bioRxiv - Neuroscience 2022Quote: The following recombinant proteins were used: CaMKIIα (#PR4586C, Invitrogen), GST-CaMKIIβ (#02-110 ...
-
bioRxiv - Microbiology 2021Quote: ... followed by incubation with recombinant Protein G agarose (Invitrogen) for 2 h at 4 °C ...
-
bioRxiv - Microbiology 2022Quote: Recombinant protein expression and purification FreeStyle 293F (ThermoFisher Scientific) cells were grown to a density of 1×106 cells/mL at 37°C with 8% CO2 with regular 135 rpm agitation ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Recombinant proteins were produced in Expi293F cells (Gibco, #A14527) following the manufacturer’s directions ...
-
bioRxiv - Microbiology 2023Quote: ... Recombinant protein A/G conjugated to HRP (Thermo Fisher) diluted 1:500 in TBST was added each well and the plates were incubated for 1 hour at 37°C then washed four times with TBST ...
-
bioRxiv - Microbiology 2023Quote: ... recombinant proteins were purified using Ni-NTA agarose (ThermoFisher), and then buffer exchanged into PBS and concentrated using Amicon Ultracel centrifugal filters (EMD Millipore).
-
bioRxiv - Immunology 2023Quote: ... recombinant SARS-CoV-2 S protein (RP-87680, Invitrogen) or recombinant SARS-CoV-2 spike RBD protein (40592-V08H ...
-
bioRxiv - Cancer Biology 2023Quote: ... 50 μl of Recombinant Protein G – Sepharose beads (Invitrogen) per condition were washed 3 times in IP buffer ...
-
bioRxiv - Immunology 2024Quote: Recombinant proteins were expressed in Expi293F cells (Life technologies). Full-length spike proteins were cloned into the pCAGGS mammalian expression vector as previously described79,80 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Membrane fraction’s protein content was normalized by using anti-transferrin receptor antibody (Invitrogen).
-
bioRxiv - Neuroscience 2023Quote: ... anti-PSD-95 (for PSD-95 single stain) (postsynaptic density protein 95; Invitrogen 51-6900; 1:250), anti-PSD-95 (for PSD- 95/C1Q co-stain ...
-
bioRxiv - Microbiology 2020Quote: ... and cultured in RPMI medium supplemented with 10% FBS and differentiated for 7 days with 20 ng/mL recombinant human Macrophage-Colony Stimulating Factor protein (M-CSF) (Thermo Fisher Scientific), and 100U/L of penicillin-streptomycin solution (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-NMDA receptor subunit 1 (1:1000, ThermoFisher PA3-102), and chicken anti-tyrosine hydroxylase (1:500 ...
-
bioRxiv - Biochemistry 2023Quote: ... 1.0 mg/mL recombinant human insulin, 0.55 mg/mL human transferrin, 0.67 μg/mL sodium selenite, Gibco), and 0.04 μg/mL dexamethasone (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell culture and other related consumables were procured from Nunc, Thermofisher and Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse transferrin receptor – TfR (1:250, ThermoFisher 13-6800), rabbit ATG9A (1:200 ...
-
bioRxiv - Cell Biology 2020Quote: ... Transferrin Receptor (TfR) H68.4 1:7500 (ThermoFisher 13-6800); Flotillin 1:1000 (CST #3253) ...
-
bioRxiv - Neuroscience 2022Quote: ... [Mouse] anti-glucocorticoid receptor (1:500, ThermoFisher, MA1-510), [Chicken] anti-GFAP (1:1000 ...
-
bioRxiv - Biophysics 2022Quote: ... and 1 μg/ml Recombinant Human Fibroblast growth Factor-basic (FGFb) (Catalog # 13256-029 Gibco, Thermo Fisher Scientific) at 37°C with 5% CO2 ...
-
bioRxiv - Biophysics 2022Quote: ... and 1 μg/ml Recombinant Human Fibroblast growth Factor-basic (FGFb) (Catalog # 13256-029 Gibco, Thermo Fisher Scientific) at 37°C with 5% CO2 ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 1% penicillin–streptomycin in 6-well plates coated with truncated recombinant human vitronectin (Thermo Fisher Scientific). The iPSC line was previously assessed for pluripotency and normal karyotype.33 For differentiation ...
-
bioRxiv - Cell Biology 2023Quote: ... were cultured in complete RPMI (10% FCS, 1% Penicillin/Streptavidin, 1% HEPES) supplemented with recombinant human M-CSF (10 ng/mL, Life Technologies) for 7-10 days to differentiate monocyte-derived macrophages (MDM) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Single-cell dissociated hiPS-CMs were plated at low density on matrigel-coated 35- mm Petri dishes (Nunc) and electrophysiological experiments were performed 12-14 days after plating ...
-
bioRxiv - Immunology 2022Quote: ... or into low adhesion microcentrifuge tubes (protein lo-bind, ThermoFisher). Tryptase was added at 12.5 ng/ml [87] ...
-
bioRxiv - Bioengineering 2019Quote: ... proteins were transferred onto a low fluorescence PVDF membrane (Invitrogen). In order to probe KRAS and β-actin separately ...
-
bioRxiv - Neuroscience 2023Quote: ... Proteins transferred onto low fluorescence PVDF membranes (ThermoFisher Scientific; USA) running over night at 4°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% mouse recombinant EGF (Invitrogen, 5% Recombinant human R-spondin (Peprotech).
-
bioRxiv - Immunology 2019Quote: ... T cells were stimulated for 2 days at a starting density of approximately 1 million cells per mL of media with anti-human CD3/CD28 Dynabeads (ThermoFisher), at a bead to cell ratio of 1:1 ...
-
bioRxiv - Immunology 2020Quote: Human mannose receptor (CD206) siRNA (UACUGUCGCAGGUAUCAUCCA) or a non-targeting siRNA sequence control (4390843, Life Technologies) were transfected into HMDM (RNAiMax ...
-
bioRxiv - Neuroscience 2019Quote: ... and 20 ng/mL recombinant human fibroblast growth factor-basic (Life Technologies). After 3 to 6 weeks ...
-
bioRxiv - Microbiology 2021Quote: ... 20 ng/ml of recombinant human epidermal growth factor (EGF, Life Technologies), human insulin (Sigma) ...
-
bioRxiv - Neuroscience 2022Quote: ... 10 ng/ml recombinant human basic fibroblast growth factor (Invitrogen, Waltham, MA) (hiPSC medium).