Labshake search
Citations for Thermo Fisher :
251 - 300 of 10000+ citations for Phosphatidylserine PS CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... using the mMessage mMachine T7 or SP6 kit and Poly(A) Tailing kit (Ambion), purified with RNeasy purification kit (Qiagen) ...
-
bioRxiv - Neuroscience 2020Quote: ... using the mMESSAGE mMACHINE T7 ULTRA kit and the MEGAshortscript T7 kit (Life Technologies), respectively ...
-
bioRxiv - Biochemistry 2020Quote: ... the GeneJET Plasmid Miniprep Kit and the GeneJET Gel Extraction Kit from Thermo Scientific were used ...
-
bioRxiv - Biophysics 2020Quote: ... Guide RNAs were expressed and purified using commercial kits (MEGAscript T7 Transcription Kit, Invitrogen and mirVana miRNA isolation Kit ...
-
bioRxiv - Biophysics 2019Quote: ... cRNA was transcribed using in vitro transcription kits (T7 RNA expression kit; Ambion Invitrogen). After 12-24 hours from harvesting and defoliculation ...
-
bioRxiv - Biophysics 2019Quote: ... cRNA was transcribed using in vitro transcription kits (T7 RNA expression kit; Ambion Invitrogen). After 12-24 hours from harvesting and defoliculation ...
-
bioRxiv - Biochemistry 2019Quote: ... polyadenylated with a Poly(A) Tailing Kit and purified with a MEGAclear Kit (Ambion).
-
bioRxiv - Molecular Biology 2022Quote: ... The kit used was the SuperScript III Platinum One-Step qRT-PCR kit (Invitrogen) according to the protocol described in (Sibai ...
-
bioRxiv - Cell Biology 2024Quote: ... kit and cDNA was synthesized using the SuperScript™ III Reverse Transcriptase kit (Invitrogen, ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... with Neon transfection kit (Invitrogen) using 2 1350V ...
-
bioRxiv - Cell Biology 2020Quote: ... with Neon transfection kit (Invitrogen) using 2 1350V ...
-
bioRxiv - Immunology 2019Quote: ... TURBO DNA-free kit (Invitrogen) was used to digest DNA from the RNA samples prior conversion into cDNA ...
-
bioRxiv - Cell Biology 2022Quote: ... Reverse transcriptase Kit (ThermoFisher Scientific) was used to synthesize cDNA from the previous extracted RNA ...
-
bioRxiv - Genomics 2019Quote: ... The BP Gateway kit (Invitrogen) was once again used to clone the cDNA which contains the polyA tail into pDONR P2RP3 ...
-
bioRxiv - Immunology 2019Quote: ... using Uncoated ELISA Kits (Invitrogen) for TNF-α ...
-
bioRxiv - Microbiology 2020Quote: ... using the MICROBEnrich kit (Ambion). Kits were used according to manufacturers’ protocols ...
-
bioRxiv - Developmental Biology 2019Quote: ... using the mMESSAGEmMACHINET7 kit (Ambion).
-
bioRxiv - Immunology 2019Quote: ... TURBO DNA-free kit (Invitrogen) was used to digest DNA from the RNA samples prior conversion into cDNA ...
-
bioRxiv - Systems Biology 2021Quote: ... TMT 10-plex kits (ThermoFisher) were used to label the 40 samples and 10 GIS mixtures ...
-
bioRxiv - Bioengineering 2020Quote: ... A Taqman PCR kit (ThermoFisher) along with an Applied Biosystems 7900HT Fast Real-Time PCR System was used to perform the real-time PCR ...
-
bioRxiv - Neuroscience 2021Quote: ... SuperSignal™ West Femto Maximum Sensitivity Substrate kit (Thermo Fisher Scientific) was used for HRP-signal detection and finally signals were visualized by ChemiDoc Imaging System (BIORAD) ...
-
bioRxiv - Neuroscience 2020Quote: ... The TA Cloning Kit (Invitrogen) was used for cloning of the amplification product (281bp ...
-
bioRxiv - Microbiology 2021Quote: ... using the KinaseMax kit (Ambion) following the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2021Quote: Tyramide SuperBoost kit (Invitrogen, USA) was used to amplify signals in co-stained tissues as per manufacturers protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... using Bioprime labelling kit (Invitrogen). 100 ng Xist fragment was added to 20 μl 2.5X random primer buffer and 9 μl nuclease free water ...
-
bioRxiv - Cell Biology 2021Quote: ... and T7 kits (Ambion #AM1344), according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... An AEC kit (Thermo Fisher) was used as a chromogen and slides were counterstained with Gills 2 hematoxylin (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2022Quote: ... with UNG kit (4440038, ThermoFisher) were used for Quantitative PCR assays.
-
bioRxiv - Plant Biology 2022Quote: ... Mini Kit (Thermo Fisher, USA) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... normalized (SequalPrep kit #1051001, Invitrogen), and submitted for sequencing to the DNASU core facility at Arizona State University ...
-
bioRxiv - Synthetic Biology 2022Quote: ... the mMachine mMessage kit (Invitrogen) was used with minor modifications ...
-
bioRxiv - Cell Biology 2022Quote: mMessage machine kit (Invitrogen, AM1348) and RNAeasy purification columns (Qiagen ...
-
bioRxiv - Bioengineering 2022Quote: ... The Superscript III kit (Invitrogen) was used to produce the cDNA ...
-
bioRxiv - Microbiology 2022Quote: ... A DNase kit (Invitrogen, CA) was used for RNA purification ...
-
bioRxiv - Genomics 2022Quote: Qubit RNA Assay Kit (ThermoFisher)
-
bioRxiv - Plant Biology 2021Quote: ... Assay Kit (Invitrogen, Paisley, UK).
-
bioRxiv - Molecular Biology 2020Quote: ... The Magnify ChIP kit (ThermoFisher) was used according to manufacturer’s instructions and as described previously (46 ...
-
bioRxiv - Neuroscience 2020Quote: ... and a cDNA kit (ThermoFisher). Primers for qPCR were ATTTTCGGCTCATTCTTCACACT (forward ...
-
bioRxiv - Immunology 2022Quote: ... purified (Megaclear RNA kit, Ambion) and analyzed on Experion (Bio-Rad ...
-
bioRxiv - Plant Biology 2022Quote: ... and TURBO DNA kit (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... the Superscript II kit (Invitrogen) was used ...
-
bioRxiv - Cell Biology 2019Quote: ... Qubit protein assay kit (Invitrogen) was used to obtain protein concentration ...
-
bioRxiv - Microbiology 2019Quote: ... using the MICROBEnrich kit (Ambion) according to manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... Commercially available kits from ThermoFisher (t-tau ...
-
bioRxiv - Molecular Biology 2019Quote: ... using MaxiScriptT7 kit (Invitrogen, AM1320). Purified m6A-containing products were serially diluted in non-m6A containing products.
-
bioRxiv - Biophysics 2020Quote: ... The mMessage mMachine kit (Ambion) was used to make mRNA as per the manufacturer’s protocol and cleanup using RNAeasy kit (Qiagen) ...
-
bioRxiv - Developmental Biology 2020Quote: ... the Neon Transfection Kit (Invitrogen) was used to transfect cells with CRISPR-mCherry (mCh ...
-
bioRxiv - Immunology 2020Quote: ... using Uncoated ELISA Kits (Invitrogen) for TNF-α ...
-
bioRxiv - Genomics 2019Quote: ... RNaqueous kit from Ambion (#AM1912); Torin 1 from Tocris (#4247) ...
-
bioRxiv - Microbiology 2019Quote: ... The Ribominus kit (Life Technologies) was used to remove rRNA from total RNA ...