Labshake search
Citations for Thermo Fisher :
251 - 300 of 10000+ citations for PKC beta 2 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... 2 h goat anti-rabbit IgG F(ab’)2-AF488 secondary antibody (Invitrogen), 15 min DAPI (1:1000) ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-rabbit IgG antibodies (1:500 for IF) and recombinant human BMP2 (#PHC7145) were from Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the cardiomyocytes were labeled with of DYKDDDDK Tag Recombinant Rabbit Monoclonal Antibody (8H8L17, Invitrogen, MA1-142-A488) at 1:500 dilution in 1% BSA ...
-
bioRxiv - Bioengineering 2024Quote: ... Sections were subsequently incubated by primary antibody 1:500 (GFP recombinant rabbit monoclonal antibody; G10362, Life Technologies) for 48 hours at 4°C followed by three PBS washes ...
-
bioRxiv - Developmental Biology 2019Quote: ... 4ng/ml beta-FGF (Thermo Scientific®; RFGFB50), 50nM PMA (Sigma ...
-
bioRxiv - Bioengineering 2021Quote: ... or mouse monoclonal anti-beta tubulin (MA516308, Invitrogen) antibodies ...
-
bioRxiv - Microbiology 2022Quote: ... and Beta-Actin (Mm02619580_g1) were from Applied Biosystems. The following forward and reverse primers were used to amplify VSig4 - 5’ GGAGATCTCATCAGGCTTGC3’ and 5’CCAGGTCCCTGTCACACTCT ...
-
bioRxiv - Cell Biology 2022Quote: ... normalization using either beta-actin (Hs99999903_1, Applied Biosystems) or GAPDH (Hs03929097_g1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.1 mM beta-mercaptoethanol (Invitrogen, Cat# 31350-010), 2 mM L-glutamine (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... Beta-actin (Catalog # MA5-11869, ThermoFisher Scientific Inc), VDAC1 (Catalog # ab 15895 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 0.1 mM Beta-Mercaptoethanol (Gibco, Cat. No. 31350010), 1000 units/mL LIF (Millipore ...
-
bioRxiv - Developmental Biology 2022Quote: ... 0.1 mM Beta-mercaptoethanol (Fisher Scientific, #21985-023), Primocin (Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... and 0.055 mM beta-mercaptoethanol (Thermo Fisher Scientific), with fresh medium added weekly ...
-
bioRxiv - Microbiology 2023Quote: ... and beta-actin (Thermo Fisher Scientific, MA5-15739). Fluorescent secondary antibodies were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... and electroporated into MegaX 10 beta cells (Invitrogen). Transformations were recovered in 1mL of SOC for 1hr at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... and 400 uL of beta-mercaptoethanol (Life Technologies).
-
bioRxiv - Cell Biology 2020Quote: ... All the signals were normalized to that of beta-actin (loading control) and the 2−ΔΔCT analysis method was used for quantification (Life Technologies). Primer sequences were designed by use of Primer3Plus software ...
-
bioRxiv - Immunology 2020Quote: ... The cells were blocked with 5 % skim milk-PBS for 1 hour at RT and incubated with an antibody against SARS-CoV-2 spike (BLSN-005P, Beta Lifescience) or control IgG (Thermo Fisher) at 4 °C overnight ...
-
bioRxiv - Molecular Biology 2020Quote: ... Rabbit antibody to pSMAD 1/5/8 (1:100; CST 9516) and mouse antibody to beta-amyloid (1:100; Invitrogen 13-200) were diluted in the same 3% blocking buffer and incubated overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... rat anti-mCherry (mAb 16D7, Life Technologies), rabbit-anti SRS9 (obtained from John Boothroyd) ...
-
bioRxiv - Cancer Biology 2020Quote: ... VSIG1 (Thermofisher MAB 4818, at 1/2000), and Vimentin (Cell Signaling Technologies 5741 ...
-
bioRxiv - Immunology 2022Quote: ... and GATA3-e660 (Invitrogen, mAb clone TWAJ) in 0.5% BSA ...
-
bioRxiv - Microbiology 2021Quote: ... mouse mAb anti-c-Myc (ThermoFisher, 9E10) and rabbit polyclonal anti-NF-κB p65 acetyl K310 (Abcam ab19870) ...
-
bioRxiv - Neuroscience 2021Quote: ... Claudin 5 (Mouse Mab, 35-2500 Invitrogen).
-
bioRxiv - Microbiology 2023Quote: ... and probed with □-His mAb (Thermo Scientific) diluted 1:1,000 in 6% milk in PBS-T followed by α-mouse IgG HRP (Bio-Rad ...
-
bioRxiv - Biochemistry 2024Quote: ... anti-GFP (Invitrogen, GF28R mAb MA5-15256), anti-α-Synuclein (Santa Cruz Biotechnology ...
-
bioRxiv - Microbiology 2021Quote: ... LS-C40832, rabbit polyclonal anti-RORC/RORC2 L-C116877 both from LSBio (Seattle, WA) and mouse mAb anti-c-Myc (ThermoFisher, 9E10).
-
bioRxiv - Cell Biology 2023Quote: ... 40D4 Mouse mAb #2920, dilution 1/2000), anti-pAKT (Cell Signalling Technology, rabbit Antibody #9271, dilution 1/1000),anti-ERK (Thermo-Fisher Scientific: Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... Membranes containing whole-cell lysates were also incubated with an HRP-conjugated rabbit anti-β-actin (Invitrogen MAB-32540, 1:1000). The Pierce ECL (Amersham ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μg/ml goat anti-rabbit F(ab’)2 fragment (Life Technologies A-21246) and goat anti-mouse F(ab’)2 fragment secondary antibodies were used ...
-
bioRxiv - Microbiology 2023Quote: The RBDs of G614, Alpha, Beta, and Omicron (BA.1, BA.2, BA.4/5) variants were ordered as GeneString from GeneArt (Thermo Fisher Scientific). All sequences of the RBD (aa 319-541 in GenBank ...
-
bioRxiv - Pathology 2023Quote: Tissue microarrays were stained using the GPER recombinant rabbit monoclonal antibody clone:20H15L21 (Thermo Fisher Scientific, catalog #703480) by DCL Pathology (Indianapolis ...
-
bioRxiv - Immunology 2022Quote: ... Both recombinant LPS (100ng/ml) and recombinant IFNy (10 ng/ml, Gibco) were provided to cells for differentiation to classical macrophages ...
-
bioRxiv - Bioengineering 2020Quote: ... the cells were fixed and stained with FITC-Mab (Hypoxyprobe) and FITC HRP MAb (Hypoxyprobe) and Hoechst (Thermo Fisher). The result of staining was then imaged using Nikon fluorescent microscope (Figure S4) ...
-
bioRxiv - Bioengineering 2022Quote: ... Rabbit anti-nidogen-2 (#PA5626615, Thermo Fisher, 1:500), Mouse anti-tenascin-C (#ab88280 ...
-
bioRxiv - Developmental Biology 2023Quote: ... anti-Sox 2 antibody (rabbit polyclonal, 1:100, Invitrogen) and anti-BrdU antibody (mouse monoclonal ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-COX-2 (1:1000, Thermo Fisher Scientific), mouse anti-MGMT (1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... Phospho-JNK1/2 (Rabbit, 1:500, Invitrogen, # 44-682G), MBP (rat ...
-
bioRxiv - Microbiology 2019Quote: ... Recombinant RNase H (Invitrogen) was later added to the reverse transcribed samples and incubated for 20 min at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... Recombinant B18R (Life Technologies) was used at 1ug/ml ...
-
bioRxiv - Cell Biology 2019Quote: A mAb producing CHOK1 cell line (CHOK1-mAb) was seeded at a density of 2 × 105 cells/ml in SFM-II media (Gibco, 12052098) in a Kuhner orbital shaker (170rpm ...
-
bioRxiv - Immunology 2022Quote: ... Fc and non-digested mAbs were removed from the flow-through by a 2 h incubation at RT with 200 µl of protein A resin per mg of initial mAb (Thermo Scientific). Finally ...
-
bioRxiv - Genomics 2023Quote: A mAb producing CHOK1 cell line (CHO K1 mAb) was seeded at a density of 2 × 105 cells/ml in 50ml SFM-II media (Gibco, 12052098) in 8 replicate shake flasks in a Kuhner orbital shaker at 170rpm at 5% CO2 ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.5% n-Dodecyl-beta-Maltoside detergent (Thermofisher Cat# 89902), Protease Inhibitor Cocktail (Roche cOmplete ...
-
bioRxiv - Neuroscience 2021Quote: ... Cholera toxin beta (Alexa 555-conjugated CTB, Thermo Fisher) was injected using a Hamilton syringe with a pulled glass capillary pipette at a rate of 0.1 μL/min to a total volume of 0.25 μL ...
-
bioRxiv - Genetics 2020Quote: ... 1:5000 dilution of anti-beta actin (BA3R, Invitrogen), followed by a 1:1000 dilution of HRP-conjugated goat anti-mouse IgG (H+L ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-beta actin (BA3R) monoclonal antibody (ThermoFisher Scientific). Species- and/or mouse isotype–specific secondary antibodies from donkey or goat and conjugated to Alexa Fluor 488 ...
-
bioRxiv - Immunology 2021Quote: ... IFN beta human ELISA kit (Thermo Fisher Scientific; 414101) was used to quantify IFNB1 ...
-
bioRxiv - Neuroscience 2023Quote: ... 50 µM beta-mercaptoethanol (#31350010, Thermo Fisher Scientific, USA), 20 ng/mL recombinant human brain derived neurotrophic factor (BDNF ...
-
bioRxiv - Neuroscience 2023Quote: ... 50 µM beta-mercaptoethanol (#31350010, Thermo Fisher Scientific, USA), 10 µM SB-431542 (#S4317 ...