Labshake search
Citations for Thermo Fisher :
251 - 300 of 10000+ citations for Killer cell immunoglobulin like receptor 2DL3 KIR2DL3 Human HEK293 His since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: HEK293 cells were cultured in Dulbecco’s modified Eagle medium (Gibco) supplemented with 10% (v/v ...
-
bioRxiv - Biochemistry 2021Quote: ... Dulbecco’s Modified Eagle’s Medium for HEK293 cells) (Gibco, Thermofisher Scientific) containing 10% (v/v ...
-
bioRxiv - Biochemistry 2021Quote: ... Dulbecco’s Modified Eagle’s Medium for HEK293 cells) (Gibco, Thermofisher Scientific) containing 10% (v/v ...
-
bioRxiv - Molecular Biology 2021Quote: HEK293-6E cells were transfected using 293fectin protocol (Thermo Fisher). The SIRT6 biosensors were expressed using mammalian expression vector pTT5 (National Research Council ...
-
bioRxiv - Microbiology 2021Quote: ... and RaTG13 RBD were produced using HEK293-F cells (Invitrogen) cultivated in suspension using Freestyle medium (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: HEK293 cells were cultured in Gibco DMEM (ThermoFisher Scientific, 10566024) supplemented with 10% FBS at 37°C with 5% CO2 ...
-
bioRxiv - Molecular Biology 2023Quote: HEK293 cells were grown in Dulbecco’s modified Eagle’s medium (Gibco) supplemented with 10% fetal bovine serum ...
-
bioRxiv - Systems Biology 2023Quote: HEK293 cells were grown and maintained in DMEM (Thermo Fisher), supplemented with 10% FBS (PAN-Biotech) ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293 and Hela cells were cultured in DMEM media (Invitrogen) supplemented with 10% FBS (Sigma) ...
-
bioRxiv - Cell Biology 2024Quote: Flp-In T-Rex HEK293 cells (Invitrogen, Thermo Fisher Scientific) were co-transfected with plasmids pOG44 (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: Flp-In T-Rex HEK293 cells (Invitrogen, Thermo Fisher Scientific) were co-transfected with plasmids pOG44 (Invitrogen ...
-
bioRxiv - Biophysics 2023Quote: ... HEK293 GnTI- cells were cultured in Freestyle 293 medium (Invitrogen) supplemented with 2% FBS on a shaker at 37 °C in the presence of 8% CO2 to a density of 3 × 106 cells per ml ...
-
bioRxiv - Cell Biology 2024Quote: FlpIn CHO and HEK293 cell lines were purchased from Invitrogen and maintained in Dulbecco’s Modified Eagle’s Medium supplemented with 5% Foetal Bovine Serum (ThermoFisher Scientific (Gibco) ...
-
bioRxiv - Developmental Biology 2024Quote: HEK293 cells were transfected using Lipofectamine 3000 (Invitrogen, Cat# L3000008) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Flp-In T-Rex HEK293 cell lines (Thermo Fisher Scientific) expressing mitochondrial-relocated golgin-BirA* fusions (from John Shin ...
-
bioRxiv - Molecular Biology 2023Quote: HEK293 Flp-In T-REx cells (Thermo Fisher Scientific, R78007) with SBP-tagged eIF4A1 integrant 15 were seeded in a 10-cm dish and cultured for 3 d in the presence of 1 μg/ml tetracycline ...
-
bioRxiv - Cell Biology 2023Quote: Flp-In™ T-REx™ HEK293 cells (Invitrogen, R78007) containing a single genomic FRT site and stably expressing the Tet repressor were cultured in DMEM medium supplemented with 10% FBS ...
-
bioRxiv - Systems Biology 2023Quote: ... HEK293 cell lines were lifted using TrypLE Express (Thermo Fisher) and resuspended in media supplemented with the appropriate volume of cADDis BacMam ...
-
bioRxiv - Immunology 2022Quote: ... HEK293 and COS-7 cells and Lipofectamine 2000 (Thermo Fisher) reagent for NIH3T3 cells ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293 cells were maintained in DMEM (Gibco™, #31966-021) supplemented with 10% FBS and 1X Non-essential Amino Acid supplement (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: HEK293 cells were cultured in Dulbecco’s modified Eagle’s medium (Gibco) supplemented with 10% fetal bovine Serum (Gibco ...
-
bioRxiv - Bioengineering 2022Quote: ... suspension HEK293 host cell line (Freestyle 293-F, ThermoFisher Scientific) was grown in Freestyle 293 expression medium (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293 Flp-In™ T-REx™ cells (Thermo Fisher) were co-transfected with the final plasmid and the pOG44 plasmid (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2023Quote: ... was transduced into HEK293 cells using Lipofectamine LTX (Invitrogen-ThermoFisher) to knock out PML by the CRISPR-Cas9 system ...
-
bioRxiv - Cell Biology 2023Quote: ... was transduced into HEK293 cells using Lipofectamine LTX (Invitrogen-ThermoFisher) to knock out PML by the CRISPR-Cas9 system ...
-
bioRxiv - Neuroscience 2023Quote: HEK293 and GL261 cells were cultured in DMEM (Gibco, #31885) with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2023Quote: ... GKO HEK293 cells were maintained in DMEM (Gibco Cat# 11995065) containing 10% FBS (Gibco Cat# 16000044) ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293 Flp-In T-Rex cells (Thermo Fisher Scientific, R78007) were transfected with pcDNA5/FRT/TO-GFP (see below ...
-
bioRxiv - Physiology 2024Quote: ... siRNAs were transfected into HEK293 cells using Lipofectamine RNAiMax (Invitrogen) according to the manufacturing instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... parental Flp-In T-Rex HEK293 cells (Thermo Fisher, R78007) were co-transfected with a 1:5 mass ratio of pcDNA/TO/Dyn1-K44A-GFP and the Flp recombinase expression plasmid ...
-
bioRxiv - Physiology 2024Quote: Flp-In T-REx HEK293 cells were sourced from Invitrogen. To generate HEK293 cells expressing mouse mPRε ...
-
bioRxiv - Biochemistry 2024Quote: ... HEK293-Flp-In T-Rex 293 cells (Thermo Fisher Scientific) were stably transfected to express HA-TDP-43 upon induction with tetracycline (1 μg/ml) ...
-
bioRxiv - Pathology 2024Quote: ... HEK293 Flp-In TRex cell line (Thermo Fisher Scientific, #R78007). HEK293T were kindly provided by Prof ...
-
bioRxiv - Cell Biology 2024Quote: ... Parental HEK293 Flp-In T-REx cells (Thermo Fisher Scientific) were cultured in growth medium containing 100 µg/ml zeocin (Invivogen ...
-
bioRxiv - Cell Biology 2024Quote: ... Tetracycline-inducible cells (tetON cells) were made in HEK293 Flp-In TReX cells (Invitrogen) (gift from Nancy Maizels) ...
-
bioRxiv - Immunology 2021Quote: Human ACE2-transfected HEK293 cells (prepared in-house) were collected and washed with FACS buffer supplemented with 2% FBS (GIBCO, CN: 10099-148) in 1X PBS ...
-
bioRxiv - Bioengineering 2020Quote: ... T cells were cultured in RPMI-1640 supplemented with 10% HI-FBS and fed with recombinant human IL-2 (ThermoFisher) and IL-15 (Miltenyi ...
-
bioRxiv - Immunology 2024Quote: ... PBMCs were transferred into a fresh falcon tube and gently resuspended in 14mL of human plasma-like media (HPLM) (Gibco) containing 10% dialysed FBS (dFBS ...
-
bioRxiv - Immunology 2020Quote: Human mannose receptor (CD206) siRNA (UACUGUCGCAGGUAUCAUCCA) or a non-targeting siRNA sequence control (4390843, Life Technologies) were transfected into HMDM (RNAiMax ...
-
bioRxiv - Cell Biology 2021Quote: HeLa cells and HEK293 Flp-In™ T-Rex cells (Thermo Fisher Scientific) were cultured in Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Molecular Biology 2021Quote: Suspension-adapted HEK293 cells (Freestyle™ 293-F cells, R790-07, Life Technologies) were grown as recommended in Freestyle™ 293 Expression Medium (12338026 ...
-
bioRxiv - Cell Biology 2023Quote: ... the HEK293-derived cells Flp-InTM T-RexTM 293 Cell Line (ThermoFisher Scientific) were stably transfected to express HA-TDP-43 upon induction with tetracycline (1 μg/mL) ...
-
bioRxiv - Cell Biology 2024Quote: ... HEK293-T cells were seeded in 10-tray Cell Factories (Thermo Fisher Scientific) 24 hours before transfection ...
-
bioRxiv - Genetics 2023Quote: ... androgen receptor (Invitrogen), PTK2 (Invitrogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... or donkey anti-goat immunoglobulin (Invitrogen; A16005) and the enhanced chemiluminescence (ECL ...
-
bioRxiv - Immunology 2023Quote: ... Immunoglobulin concentration was estimated by NanoDrop (ThermoFisher) or human IgG ELISAs (Bethyl Laboratories).
-
bioRxiv - Microbiology 2024Quote: ... Immunoprecipitation with non-specific immunoglobulins (Applied Biosystems) was included in each experiment as a negative control ...
-
bioRxiv - Immunology 2024Quote: ... 0.5% normal rat immunoglobulin G (Invitrogen, 10700), and 2.4G2 (1 µ g/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... Capillary-like tubes were then stained with cell-permeable dye Calcein AM (ThermoFisher, C1430) and imaged by fluorescence microscopy.
-
bioRxiv - Immunology 2023Quote: Human-derived cell lines used in this study were initially obtained from accredited commercial suppliers: (1) HEK293 (human embryonic kidney cell line, FreeStyle® 293-F) was obtained from Invitrogen (San Diego, CA) for use as a recombinant protein expression vehicle ...