Labshake search
Citations for Thermo Fisher :
251 - 300 of 3172 citations for HVEM Rhesus Macaque HEK 293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: HEK 293 cells were cultured at 37 °C and 5% CO2 using DMEM high glucose without phenol red (Gibco, Thermo Fisher Scientific), supplemented with 10% fetal bovine serum ...
-
bioRxiv - Biochemistry 2024Quote: HEK-293 cells (ATCC, CRL-1573) were subcultured every 3-4 days in Dulbecco’s modified Eagle’s medium (Thermo Fisher Scientific, 41965-039) supplemented with 10% v/v fetal bovine serum (Sigma Aldrich ...
-
bioRxiv - Biophysics 2021Quote: Wild-type SCN5A (Q1077del NaV1.5)16 was co-transfected with pEGFP-C1 into HEK-293 cells with Lipofectamine 3000 reagent (Thermo Fisher Scientific, Massachusetts, USA).
-
bioRxiv - Pharmacology and Toxicology 2019Quote: HEK-293 cells or HEK-293 cells stably expressing PAR4-YFP were loaded with calcium sensitive dye (Fluo-4 NW, F36206, Life Technologies, Thermo Fisher) and aliquoted into cuvettes with Hanks buffered salt solution (HBSS containing Ca2+ and Mg2+) ...
-
bioRxiv - Neuroscience 2020Quote: Destabilized EGFP reporter with or without 3’UTR of interest was transduced into HEK 293 cells to establish a stable reporter containing cell line with Blasticidin S HCl (Life Technologies, A11139-03) selection ...
-
bioRxiv - Biochemistry 2022Quote: ... The resulting plasmids with Fpn or the empty plasmid were transfected into HEK 293S cells on 6-well plates with 293fectin™ transfection reagent (Invitrogen/Thermo Fisher) per the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Human embryonic kidney 293 cells (HEK-293T) (ATCC, Manassas, VA, US) were grown in Dulbecco’s Modified Eagle’s medium (DMEM) (Thermo Fisher Scientific, Waltham, MA, US) supplemented with 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2023Quote: Human embryonic kidney (HEK) 293 cells (RIKEN Cell Bank, Tsukuba, Ibaraki, Japan) were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Thermo Fisher Scientific, Waltham, MA, USA) with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Cell Biology 2024Quote: ... HEK-293 cells with 80% of confluency were transfected using 250ng/ml of pCMVHA hEZH2 and Lipofectamine 2000 (#11668030, Invitrogen, Thermo Fisher Scientific) for 4 hrs ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... HEK-293 cells were maintained at 37°C with 5% CO2 in Dulbecco’s minimum essential medium (DMEM/F12; Gibco, Life Technologies, Grand Island, NY) supplemented with 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... lentiviral construct that expressed luciferase was co-transfected with lentiviral packaging plasmids psPAX2 and pCMV-VSVG into HEK-293 FT cells using Lipofectamine® 3000 (Thermo Scientific, Waltham, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Freestyle 293 (ThermoFisher) cells were subsequently centrifuged and resuspended in Freestyle293 media (ThermoFisher ...
-
bioRxiv - Microbiology 2020Quote: ... 1.8L of 293-6E cells grown in Freestyle 293 media (Invitrogen) to 0.8×10e6 cells/ml were transfected with linear PEI (Polysciences ...
-
bioRxiv - Microbiology 2021Quote: The rhesus monkey kidney epithelial MA104 cells were grown in medium 199 (Gibco) supplemented with 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2023Quote: Telomerized rhesus fibroblasts (TeloRFs) were maintained in Dulbecco’s modified Eagle medium (DMEM, Gibco) containing 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2019Quote: ... HEK 293FT (Invitrogen), and mouse Shh-LIGHT2 cells (37 ...
-
bioRxiv - Cancer Biology 2020Quote: HEK-293EBNA (Invitrogen) and A673 cells (ATCC ...
-
bioRxiv - Microbiology 2020Quote: ... HEK 293A (Invitrogen) and HEK 293T cells (ATCC ...
-
bioRxiv - Neuroscience 2024Quote: ... HEK-293FT (Invitrogen) cells were maintained in complete medium (4.5g/L Glucose and L-Glutamine containing DMEM supplemented with 10% FBS and 1% Pen-Strep ...
-
bioRxiv - Systems Biology 2020Quote: HEK293 cell lines 293-F and Freestyle 293-F were cultivated in Freestyle 293 expression medium (Gibco, Thermo Fisher Scientific) at 37°C ...
-
bioRxiv - Systems Biology 2020Quote: HEK293 cell lines 293-F and Freestyle 293-F were cultivated in Freestyle 293 expression medium (Gibco, Thermo Fisher Scientific) at 37°C ...
-
bioRxiv - Immunology 2020Quote: ... cells were incubated with sgRNA complementary to exon 3 of HVEM (GCCAUUGAGGUGGGCAAUGU + Scaffold, TrueGuide Synthtetic guide RNAs, Invitrogen™), Cas9 nuclease (TrueCut™ Cas9 Protein v2 ...
-
bioRxiv - Immunology 2024Quote: ... tagged with human IgG Fc was transiently transfected using FreeStyle 293-F cells and purified using Protein G Plus Agarose (Pierce Thermo Fisher Scientific). RBD-SD1 was cleaved from the Fc by incubation with 3C protease (produced in-house ...
-
bioRxiv - Systems Biology 2021Quote: ... 293-F (Gibco™) and Freestyle™ 293-F (Gibco™ ...
-
bioRxiv - Cell Biology 2021Quote: ... T-Rex-293 (Invitrogen), IMCD3 Flp-In ...
-
bioRxiv - Biochemistry 2021Quote: ... Expi-293 cells (ThermoFisher) were mock transfected or transfected with pWT-SARS-2-spike or pD614G-SARS-2-spike described for pseudovirus assays above ...
-
bioRxiv - Molecular Biology 2023Quote: ... Expifectamine 293 Enhancers (GIBCO) were added to the cells.
-
bioRxiv - Neuroscience 2023Quote: Expi 293 cells (ThermoFisher) were used for scFv expression ...
-
bioRxiv - Immunology 2024Quote: 293-F (ThermoFisher, #R79007) and Expi293F cells (ThermoFisher ...
-
bioRxiv - Neuroscience 2020Quote: The macaque retinae were cut into pieces and lysed by Trizol (Life Technologies, USA), including Cas9-RHO- and Cas9-CTRL-infected and uninfected retinae ...
-
bioRxiv - Immunology 2021Quote: ... following the manufacturer’s instructions and with Rhesus-specific TaqMan gene expression primers (Life Technologies). Eukaryotic 18S rRNA (Life Technologies ...
-
bioRxiv - Biochemistry 2020Quote: Freestyle 293-F cells were grown in Freestyle 293 expression medium (Thermo Fisher) in suspension culture ...
-
bioRxiv - Genomics 2024Quote: Freestyle 293-F cells were grown in Freestyle 293 Expression Medium (ThermoFisher Scientific) at 37°C and 8% CO2 while shaking at 135 rpm ...
-
bioRxiv - Biochemistry 2023Quote: ... Freestyle 293 Expression Medium and Expi 293 Expression Medium were purchased from Gibco, along with Expi293F cells and the ExpiFectamine 293 Transfection Kit ...
-
bioRxiv - Developmental Biology 2021Quote: ... and HEK-A (ThermoFisher) were maintained in Dulbeccos Modified Medium (DMEM ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... and HEK-A (ThermoFisher) were maintained in Dulbeccos Modified Medium (DMEM ...
-
bioRxiv - Bioengineering 2020Quote: HEK 293F cells (Invitrogen) were cultured in Freestyle medium (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... and HEK-A (ThermoFisher) were maintained in Dulbeccos Modified Medium (DMEM ...
-
bioRxiv - Biophysics 2020Quote: ... HEK 293F cells (Invitrogen) were transfected with the four plasmids and harvested after 60 hours ...
-
bioRxiv - Cell Biology 2022Quote: HEK-293FT cells (Invitrogen) were cultured in 1x DMEM ...
-
bioRxiv - Immunology 2022Quote: HEK-293T cells (Invitrogen) were transfected using SARS-CoV-2 S expression plasmid expression vector and lipofectamine (thermofisher ...
-
bioRxiv - Immunology 2021Quote: ... samples collected from challenged macaques or standards were reverse-transcribed using Superscript III VILO (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: Heart tissues from mice or rhesus monkeys were crushed by homogenizer (Power Gen125, Fisher Scientific) and then lysed in lysis buffer (50 mM Tris ...
-
bioRxiv - Cell Biology 2021Quote: ... FreeStyle™ 293-F cells were grown in FreeStyle™ 293 Expression Medium (Gibco) under constant agitation at 37 °C with 5% CO2 in a humidified incubator.
-
bioRxiv - Biochemistry 2021Quote: ... FreeStyle 293-F cells were grown in suspension in FreeStyle 293 Expression Medium (Gibco).
-
A quantitative analysis of the interplay of environment, neighborhood and cell state in 3D spheroidsbioRxiv - Systems Biology 2020Quote: T-REx-293 cells (Invitrogen) and DLD1 cells (Flp-In T-Rex DLD-1 ...
-
bioRxiv - Microbiology 2021Quote: ... T-REx-293 cells (Invitrogen) were grown in DMEM supplemented with blasticidin (10 µg/mL ...
-
bioRxiv - Microbiology 2021Quote: T-REx-293 cells (Invitrogen), which constitutively expresses the Tet repressor (TetR ...
-
bioRxiv - Microbiology 2021Quote: FreeStyle 293-F (Thermo Fisher) cells were grown to a density of 1×106 cells/mL at 37°C with 8% CO2 with regular 135 rpm agitation ...
-
bioRxiv - Systems Biology 2022Quote: ... ExpiFectamine 293 Reagent (Thermo Fisher) was diluted with Opti-MEM separately then combined with diluted plasmid DNA for 10 minutes at room temperature ...