Labshake search
Citations for Thermo Fisher :
251 - 300 of 10000+ citations for 6 TRIFLUOROMETHYL 1 2 3 4 TETRAHYDRO ISOQUINOLINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... incubated with DAPI (4′,6-diamidino-2-phenylindole, Invitrogen, catalogue number D1306) (0.5 µg/ml in PBS ...
-
bioRxiv - Neuroscience 2020Quote: ... slices were counterstained with DAPI (4’, 6-diamidino-2-phenylindole, ThermoFisher Scientific). Sections were then mounted on slides in Vectashield (Vector Laboratories) ...
-
bioRxiv - Cancer Biology 2020Quote: ... incubated with 0.5 µg/ml 4′,6-diamidine-2-phenylindole (DAPI; Invitrogen) for 5 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... incubated with 0.5 µg/ml 4′,6 diamidine-2-phenylindole (DAPI; Invitrogen) for 5 min ...
-
bioRxiv - Neuroscience 2022Quote: ... incubated with 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI, D1306; Molecular Probes) in PBS and mounted with ProLong Gold Antifade Mountant (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Sulfosuccinimidyl 6-(4’-azido-2’-nitrophenylamino) hexanoate (Sulfo-SANPAH; 22589) from ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2019Quote: ... clusters were stained with 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, D1306) and Alexa Flour 633-conjugated Phalloidin (Invitrogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... Nuclei were labeled with 4’,6-diamidino-2-phenylindole (DAPI, Life Technologies) and mounted in Fluoro Care Anti-Fade mounting media (Biocare Medical ...
-
bioRxiv - Cell Biology 2020Quote: ... 2-(4-amidinophenyl)-1H -indole-6-carboxamidine (DAPI; Thermo Fisher Scientific – D1306), 5X All-In-One RT MasterMix with AccuRT Genomic DNA Removal Kit (Applied Biological Material - G492) ...
-
bioRxiv - Immunology 2021Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) or Live/ dead fixable blue (ThermoFisher) was used to discriminate live/dead cells ...
-
bioRxiv - Immunology 2020Quote: ... DNA was visualized with 4′,6-diamidino-2-phenylindole (DAPI) (Life Technologies). Sections were imaged with a Zeiss Cell Observer inverted microscope using a 40x objective ...
-
bioRxiv - Cell Biology 2021Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI, Life Technologies) (1:1000) ...
-
bioRxiv - Immunology 2021Quote: ... Nuclei were stained using 4’,6-Diamidin-2-phenylindol (DAPI, Invitrogen, #D1306) and images were acquired at a distance of 900 μm from the border of the lesion in layer 4 (ipsilateral ...
-
bioRxiv - Neuroscience 2022Quote: ... incubated with 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI, D1306; Molecular Probes) in PBS and mounted with ProLong Gold Antifade Mountant (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen D1306; to label nuclei) using the following protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were counterstained with DAPI (4’,6-Diamidine-2’-phenylindole dihydrochloride - Invitrogen) for staining nuclei ...
-
bioRxiv - Immunology 2023Quote: ... and counterstained with DAPI (4’, 6-diamidino-2-phenylindole, Thermo Fisher Scientific). Sections were examined with a Nikon A1 confocal microscope and LY molecule tissue infiltration (depicted in green channel images included in Fig 4C ...
-
bioRxiv - Developmental Biology 2023Quote: ... with 4′6-diamidino-2-phenylindole (DAPI, 00-4959-52, Thermo Fisher), was used to visualize nuclei and as mounting medium ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4′,6-Diamidino-2-phenylindole (DAPI; D1306; Thermo Fisher Scientific, Waltham, MA) was used to stain cell nuclei ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were counterstained with DAPI (4’,6-diamidino-2-Phenylindole, Dihydrochloride - Invitrogen) for staining nuclei ...
-
bioRxiv - Cancer Biology 2023Quote: ... and stained with 4′,6-diamidino-2-phenylindole (DAPI) (ThermoFisher Scientific: D1306) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... incubated with 4′,6-diamidino-2-phenylindole (DAPI) as directed (Invitrogen, D1306), and washed with PBS ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were stained with 4′,6′-diamidino-2-phenylindole (DAPI) (Thermo Fisher) nuclear stain diluted in PBS for 5 min with rocking ...
-
bioRxiv - Bioengineering 2023Quote: ... Slowfade gold antifade mountant containing 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) was used to rinse and seal the coverslips ...
-
bioRxiv - Genetics 2023Quote: ... and stained with DAPI (4′,6-diamidino-2-phenylindole) (Thermo Fisher Scientific). Germlines were mounted in Vectashield (VectorLabs ...
-
bioRxiv - Microbiology 2023Quote: ... the fluorescent dsDNA-labelling dye 4′,6-diamidino-2-phenylindole (DAPI, ThermoFisher) was added to the culture at a concentration of 5 µg.mL−1 for 10 minutes prior imaging ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.25 μg/ml of 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes) was added to immunolabeled cells for 10 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... Samples were then counterstained with 4′,6-diamidino-2-phenylindole (DAPI) (ThermoFisher) solution in PBS for 15 min and washed three times with PBS ...
-
bioRxiv - Bioengineering 2024Quote: ... then incubated with 4’-6-diamidino-2-phenylindole (DAPI; Invitrogen, Waltham, MA) for 20 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... Nuclei were stained with 4′,6-Diamidin-2-phenylindol (DAPI, Invitrogen, #D1306) 1:10,000 or DRAQ5 (ThermoFisher ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific, Waltham, MA, USA) was used to label all nuclei ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Cell Biology 2022Quote: ... the samples were added with a DNA-binding dye 4′,6-diamidino-2-phenylindole (DAPI, 1 µg mL-1 in PBS, Invitrogen) and phalloidin conjugated Alexa Fluor dye (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... resuspended in 1 mL NSB with 1:20 dilution of 0.25 mg/ml 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen D1306) and FACS sorted ...
-
bioRxiv - Biophysics 2023Quote: ... the samples were added with a DNA-binding dye 4’,6-diamidino-2-phenylindole (DAPI, 1 μg mL-1 in PBS, Invitrogen) along with the secondary antibody solution ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 x10^6 in 6 cm dishes or 4 x10^6 in 10 cm dishes (Nunc Edge plates, Thermo Fisher Scientific) in conditioned NB or NB-Plus ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 x10^6 in 6 cm dishes or 4 x10^6 in 10 cm dishes (Nunc Edge plates, Thermo Fisher Scientific) in conditioned NB or NB-Plus ...
-
bioRxiv - Bioengineering 2023Quote: ... 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium (WST-8) was purchased from ThermoFisher Scientific.
-
bioRxiv - Cell Biology 2021Quote: ... cells were incubated for overnight with primary antibody at 4 degrees and further incubated with secondary antibodies (1:500) for 1 hour followed by 4′,6-diamidino-2-phenylindole (DAPI) or phalloidin 488 (1:400, Thermo Fisher, A12379) staining ...
-
bioRxiv - Neuroscience 2020Quote: ... Nuclei were stained with 4′,6′-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng/ml, Molecular Probes). The sections were mounted using a fluorescence mounting medium (DAKO ...
-
bioRxiv - Genomics 2023Quote: ... The nuclear stain was 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng/mL; Molecular Probes). Sections were imaged digitally using a slide scanner (Olympus VS-120 Slide scanner ...
-
bioRxiv - Neuroscience 2021Quote: ... 6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:10000) and then washed before mounting with FluorSave (Calbiochem).
-
bioRxiv - Cell Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:10000) and then washed before mounting with a FluorSaveTM reagent (Merck-Millipore).
-
bioRxiv - Cancer Biology 2023Quote: ... anti-CD11a (1:50, IBL-6/2, Invitrogen), and FITC anti-PD-1 (1:50 ...
-
bioRxiv - Neuroscience 2019Quote: ... Nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI, 1:5000 in PBS) (Molecular Probes, Eugene, OR). The TUNEL stain signal was observed under an FV300 confocal microscope (Olympus Optical Company ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then stained with 1 μg/mL 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes/Thermo Fisher) and analysed on a FACSVERSE (BD Biosciences) ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then stained with 1 μg/mL 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes/Thermo Fisher) and analysed on a FACSVERSE (BD Biosciences) ...
-
bioRxiv - Physiology 2020Quote: ... DAPI (4’,6-Diamidino-2-Phenylindole Dihydrochloride; 1:2000 diluted in PBTD; Thermo Fisher Scientific, Stockholm, Sweden; 62248) was added for 3 minutes followed by washing in PBTD for 25 minutes and mounting with ProLong gold antifade reagent (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... slices were counterstained with 4’,6-diamidine-2’-phenylindole 502 dihydrochloride (DAPI, D3571, Molecular Probes; dilution 1:1000) for 5 minutes followed by 2 minutes wash in PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... Nuclei were counterstained using 4′,6-diamidin-2-phenylindol (DAPI, 1:1000, 7 min; D1306, Thermo Fisher Scientific). Washing steps were performed with PBS ...