Labshake search
Citations for Thermo Fisher :
251 - 300 of 10000+ citations for 2 Methoxy 2 3 4 5 Tetrabde Unlabeled 50 Ug Ml In Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... and 50 nM 2-mercaptoethanol (Gibco). Naive CD4+ T cells were isolated by magnetic sorting using the mouse naïve CD4+ T cell isolation kit on the AutoMACS system (Miltenyi ...
-
bioRxiv - Cell Biology 2024Quote: ... 50 μM 2-Mercaptoethanol (Gibco, 31350010), 0.025% Human Insulin Solution (Sigma Aldrich ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 50 mM 2-Mercaptoethanol (Thermo Fisher) supplemented with 500 nM A-83–01 (Sigma Aldrich) ...
-
bioRxiv - Biochemistry 2023Quote: ... and 50 nM 2-mercaptoethanol (Gibco). Naive CD4+ T cells were isolated by magnetic sorting using the mouse naïve CD4+ T cell isolation kit on the AutoMACS system (Miltenyi ...
-
bioRxiv - Microbiology 2019Quote: ... 2 mM 3-methyl-2-oxobutanoic acid (Fisher Scientific, Hampton, NH) and 1 mM acetyl-CoA (Sigma-Aldrich ...
-
bioRxiv - Immunology 2024Quote: ... 5×10-5 M 2-mercaptoethanol (Gibco) and 50µg/mL Gentamicin (Lonza ...
-
bioRxiv - Bioengineering 2024Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Invitrogen, Cat # N13195) and incubated for 30 minutes in their respective culture conditions ...
-
bioRxiv - Genomics 2021Quote: ... and incubated with AbDil containing 2 ug/ml Alexa 647 fluorophore conjugated goat anti-rabbit secondary antibody (Molecular Probes) for 30 minutes ...
-
Enzymatic RNA Biotinylation for Affinity Purification and Identification of RNA-protein InteractionsbioRxiv - Biochemistry 2020Quote: HeLa cell pellets (∼2×107) or MCF7 cell pellets (∼4×107) were lysed with 3 mL Mammalian Protein Extraction Reagent (Thermo Scientific), supplemented with 2X HALT protease inhibitor (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... collected into a new tube and stained with 4′,6-diamidino-2-phenylindole (DAPI) (∼5 µg/ml, Molecular Probes # D1306). Round coverslips (Ø12 mm ...
-
bioRxiv - Cell Biology 2021Quote: ... 2X SSC) for 5 min and counter stained with 1 μg/ml DAPI (4’,6-diamidino-2-phenylindole; Life Technologies). Coverslips were mounted in imaging buffer (3.7 μg/μl glucose oxidase and 1U catalase in equilibration buffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.7 mL Buffer 2 (1 M sorbitol, 50 mM MES, pH 6, 5 mM MgCl2) plus protease inhibitors (Thermo Scientific A32955) was added ...
-
bioRxiv - Biophysics 2023Quote: ... 2’(3’)-O-(2,4,6-trinitrophenyl)-adenosine 5’-triphosphate (TNP-ATP) was purchased from Invitrogen as a trisodium salt and stored in the dark at -20 °C at 10 mg/ml_ ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4ºC) and incubated with 50 μL of 5 μM DAF-FM (4-amino-5methylamino-2’,7’-dichlorofluorescein diacetate, Life Technologies, Eugene, OR, USA) diluted in 1X PBS for 30 min at 34 °C ...
-
bioRxiv - Microbiology 2019Quote: ... lentiviral containing supernatant and selected using 2-4 μg/ml puromycin (Gibco) for 3-4 days.
-
bioRxiv - Neuroscience 2020Quote: ... and 4’,6’-diamidino-2-phenylindole dihydrochloride (1 µg/ml, Life Technologies) for 2 hr ...
-
bioRxiv - Microbiology 2020Quote: ... 10 ml 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Gibco), 24 mL 5% NaHCO3 (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... incubated with 0.5 µg/ml 4′,6-diamidine-2-phenylindole (DAPI; Invitrogen) for 5 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... incubated with 0.5 µg/ml 4′,6 diamidine-2-phenylindole (DAPI; Invitrogen) for 5 min ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.25 μg/ml of 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes) was added to immunolabeled cells for 10 min ...
-
bioRxiv - Systems Biology 2019Quote: ... 50 U/mL of penicillin/streptomycin with 2 mM L-glutamine (Life Technologies), 0.1 mM non-essential amino acid (Life Technologies) ...
-
bioRxiv - Microbiology 2020Quote: ... 2 mM L-alanyl-L-glutamine (Biochrom) and 50 μg/ml Gentamicin (Gibco). The snake cells were maintained at 30°C and mammalian cells at 30°C or 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... 2 mM L-glutamine and 50 μg/ml of penicillin and streptomycin (Invitrogen). Cells were incubated at 37°C in 5% CO2 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 50 μL of 2 mg/mL single-stranded salmon sperm DNA (Invitrogen, 15632011), 0.1–10 μg DNA ...
-
bioRxiv - Immunology 2023Quote: ... 2 mM L-Glutamine and 50 U/mL Penicillin/Streptomycin (ThermoFisher Scientific (TFS), Paisley ...
-
bioRxiv - Cancer Biology 2020Quote: ... Proton transport was measured using ATP-dependent quenching of 9-amino-6-chloro-2-methoxy-acridine (Acridine Orange, ThermoFisher) fluorescence quenching for isolated vacuoles as previously described21
-
bioRxiv - Cancer Biology 2021Quote: ... 2 uM FluoZin-3 AM (Invitrogen) was add to dishes to stain cells for 1 hour and then was washed twice with PBS ...
-
bioRxiv - Bioengineering 2023Quote: ... 50 mg Sulfo-SANPAH (sulfosuccinimidyl 6-(4’-azido-2’- nitrophenylamino)hexanoate) (cat. 22589, ThermoFisher Scientific) was dissolved in 1 ml DMSO and diluted 25-times in Milli-Q water ...
-
bioRxiv - Bioengineering 2022Quote: ... cells were rinsed in DPBS and incubated with 2 μg/ml DAPI (4′,6-diamidino-2-phenylindole, 62248; ThermoFisher) and 1:500 Alexa Fluor Plus 647 conjugated goat anti-rabbit secondary antibodies (A32733 ...
-
bioRxiv - Systems Biology 2023Quote: ... A 1 mL aliquot of 2:2:1 (v/v) mixture of ≥ 99.9% purity acetonitrile (Fisher Scientific; Cat.A998-4) ≥ 99.8% purity methanol (Fisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... Cell nuclei were counter stained with 4’,6’-diamidino-2-phenylindole dihy-drochloride (DAPI; 2 ng/ml; Molecular Probes) prior to mounting onto glass slides and then cover slipped with ProLong Gold (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... 200 ug/mL (Invitrogen). The DNA quantified by 1% agarose gel electrophoresis and ethidium bromide staining ...
-
bioRxiv - Immunology 2020Quote: ... 2-mercaptoethanol (5 µM, Gibco) and 150 IU/ml human rIL-2 and 50ng/ml rIL-15) ...
-
bioRxiv - Immunology 2021Quote: ... 50U/50 ug penicillin-streptomycin (Life Technologies), 2 mM glutamine (Life Technologies) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and TNFα (10 ng/ml) for 6 h and stained for cleaved Caspase 3/7 green (5 µM) and propidium iodide (2 µM) (Thermo Scientific) for an additional 30 min ...
-
bioRxiv - Cell Biology 2020Quote: ... or BODIPY™ 558/568 C12 (4,4-Difluoro-5-(2-Thienyl)-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Developmental Biology 2021Quote: Embryos and larvae from 9 hpf to 4 wpf were incubated in 3 µM 5-Ethynyl-2′-deoxyuridine (EdU; ThermoFisher Scientific, cat#: C10639) in FSW for 15-30 min ...
-
bioRxiv - Neuroscience 2019Quote: ... cortical cultures were loaded with fluo-4 AM (3 μM) or fura-2 AM (3 μM) plus 0.1% Pluronic F-127 (ThermoFisher) in a HEPES-buffered saline solution (HCSS ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Immunology 2021Quote: ... cells were incubated in 2-(N-(7-nitrobenz-2-oxa-1,3-diaxol-4-yl) amino)-2-deoxyglucose (2-NBDG) (Invitrogen) (20 µM ...
-
bioRxiv - Physiology 2021Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Thermo Fisher Scientific, USA) was dissolved in saline solution at 5 mg/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... (2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG) (100 μM; ThermoFisher Scientific) with Hoechst (1 μg/mL ...
-
bioRxiv - Physiology 2019Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Thermo Fisher Scientific, USA) was dissolved in PBS at 5 mg/ml ...
-
bioRxiv - Immunology 2022Quote: ... cells were resuspended in glucose-free media containing 150 μM 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG Thermofisher) and incubated for 45 minutes at 37°C.
-
bioRxiv - Bioengineering 2021Quote: ... and 4000 cells per well were seeded in 50 µl EGM-2 medium containing 50 U/ml penicillin and 50μg/ml streptomycin (P/S) (Gibco, 15140-122) into 384 well plates (Greiner Bio-One ...
-
bioRxiv - Cell Biology 2021Quote: ... and 4000 cells per well were seeded in 50μL EGM-2 medium containing 50 U/mL penicillin and 50 μg/mL streptomycin (P/S) (Gibco, 15140-122) into 384 well plates (Greiner Bio-One ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP, dGTP and dCTP, 3 mM dTTP and 2 mM 5-(3-aminoallyl)-dUTP (Thermo Fisher Scientific, AM8439)) and 1.25 µL of 40 µM oligo 1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Neuroscience 2021Quote: ... TRPA1−/− male mice were loaded with Fura-2 (3 μg/mL, Life Technologies) and pluronic acid (1:1 ...
-
bioRxiv - Immunology 2023Quote: ... and the pellet resuspended in 2-3 mL of TrypLE Express (Gibco # 12605010) for 15-20 min at 37°C to dissociate the organoids into single cells ...