Labshake search
Citations for Thermo Fisher :
251 - 300 of 10000+ citations for 2 3 Cyclohexenyl Ethyltrimethoxysilane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: Anti-ORF8 mAb (#1-3-2) was coupled to aldehyde/sulfate latex beads (Thermo Fisher Scientific A37304). The antibody was mixed with the latex beads and shaken at room temperature overnight ...
-
bioRxiv - Microbiology 2022Quote: ... adding 3 mL HPLC grade methanol and 2 mL HPLC grade chloroform (C297-4, Thermo Fisher Scientific), then shaking at 22°C for 1 hr ...
-
bioRxiv - Immunology 2024Quote: ... The supernatant was collected on day 3 and analyzed by human IL-2 ELISA Kit (Thermo Fisher) according to the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2024Quote: Proliferation assays were performed using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Thermo Fisher Scientific) assay ...
-
bioRxiv - Genomics 2024Quote: ... A 2-3 cm2 skin biopsy harvested and transferred into NMR fibroblast medium: alphaMEM (Gibco™ 12571063) containing 15% FBS (Cytiva ...
-
bioRxiv - Immunology 2024Quote: Jurkat cells were loaded with 3 µM Fura-2 AM and 0.05% Pluronic®F-127 (Invitrogen) in imaging buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... or F-12K medium (Caisson; Hela-S3 and PC-3) supplemented with 2 mM L-glutamine (Gibco), 100 U/mL penicillin ...
-
bioRxiv - Neuroscience 2021Quote: ... Cultured neurons were incubated with 3 μg/mL of the ratiometric calcium indicator Fura-2 AM (Life Technologies) in external recording solution for 30 min at 37°C and 5% CO2 ...
-
bioRxiv - Neuroscience 2020Quote: ... was aspirated and the fixed cells treated with 2-3 drops of ProLong Gold Antifade Mountant (Invitrogen #P36930) before imaging ...
-
bioRxiv - Plant Biology 2020Quote: ... seedlings were washed for 2-3 min in water and transferred to a chambered cover glass (Thermo Scientific), and imaged either as described above or using a Leica DM5500 wide field microscope (GFP filtercube ex ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was reverse-transcribed by addition of 3 μl of RT mix (2 μl 5x SSIV buffer [Invitrogen] ...
-
bioRxiv - Microbiology 2020Quote: ... Myoblat and myotubes viability was determined by 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (MTT; Life Technologies) metabolization.
-
bioRxiv - Cancer Biology 2020Quote: ... then assayed in a standard MTT assay: 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (ThermoFisher, Waltham, MA) [39] ...
-
bioRxiv - Cancer Biology 2021Quote: ... After 3 and 7 days of treatment cells were stained with 2% crystal violet (CV) (40583100, Acros Organics, Fisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... equipped with an Acclaim Pepmap C18 trap column (2 cm * 75 µm, particle size: 3 µm; Thermo Fisher) and a C18 analytical column (50 cm * 75 µm ...
-
bioRxiv - Neuroscience 2022Quote: ... the cerebral cortexes from 2-3 P3-P5 C57BL/6 mice were collected in ice cold HBSS (Invitrogen), the tissue was washed three times with HBSS and digested with 0.04% trypsin (Sigma ...
-
bioRxiv - Genetics 2021Quote: ... Gels were run at 120V for 2-3 hours in Bolt MES SDS Running Buffer (Thermo Fisher Scientific) prior to protein transfer to Amersham Protran nitrocellulose blotting membrane (GE Healthcare ...
-
bioRxiv - Neuroscience 2021Quote: ... supplemented with NeuroCult™ SM1 neuronal supplement (STEMCELL), L-glutamine (2 mM, PAA) and 3% horse serum (Invitrogen) at 37°C in 5% CO2 ...
-
bioRxiv - Cancer Biology 2022Quote: Tail and ear fragments from C57/B6 or mT/mG mice were dissected and incubated in 2-3 hours at 37 °C in 950 µL of Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen), supplemented with 10% inactivated fetal bovine serum (FBSi ...
-
bioRxiv - Zoology 2020Quote: ... 2’-(4-ethoxyphenyl)-5-(4-methyl-1-piperazinyl)-23491-52-3 (Hoechst 33342, trihydrochloride, trihydrate, Life Technologies, H3570) in water for 20 min ...
-
bioRxiv - Cell Biology 2020Quote: ... and induced to differentiate in myotubes for 2-3 days in differentiation media (DM: IMDM (Gibco, 21980-032) + 2% of horse serum (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were treated with DMNB-caged cAMP (4,5-Dimethoxy-2-Nitrobenzyl Adenosine 3’,5’-Cyclicmonophosphate, Molecular Probes, D1037) for at least 30 minutes prior to imaging at a final concentration of 1 mM ...
-
bioRxiv - Immunology 2020Quote: Cell viability was estimated by a quantitative colorimetric assay described for human granulocytes which were based on metabolic reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Invitrogen) into coloured product formazan (Oez ...
-
bioRxiv - Microbiology 2023Quote: ... the cells were loaded with 2 µM CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific), according to the manufacturer’s instructions for kinetic assays and fluorescence in the live cells ...
-
bioRxiv - Genomics 2023Quote: ... All nuclei were pooled and stained with DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306). Using a FACSAria III cell sorter (BD Biosciences) ...
-
bioRxiv - Pathology 2023Quote: Tail and ear fragments from mT/mG mice were dissected and incubated in 2-3 hours at 37 °C in 950 µL of Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen), supplemented with 10% inactivated fetal bovine serum (FBSi ...
-
bioRxiv - Genetics 2023Quote: ... 3-5 million cells or approximately 15 ug of DNA crosslinked with 2% PFA (Fisher Scientific F79-500) were used as input per reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were treated with DMNB-caged cAMP (4,5-Dimethoxy-2-Nitrobenzyl Adenosine 3’,5’-Cyclicmonophosphate, Molecular Probes, D1037) for at least 30 min prior to imaging at a final concentration of 1 mM ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Cancer Biology 2024Quote: ... or using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) reagent (Fisher Scientific, AC158992500, Waltham, MA, USA) at 570 nm ...
-
bioRxiv - Cell Biology 2024Quote: ... and a lentiviral transfer plasmid (2:3:4 ratio by mass) using Lipofectamine 3000 (Thermo Fisher Scientific L3000015). Viral supernatant was harvested 48h after transfection and filtered through 0.45 µm cellulose acetate filters (Corning 431220) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mix 1 contains 3 siRNAs (CliniSciences, CRH7929) and Mix 2 contains two siRNAs (ThermoFisher Scientific, 1299001 and 4392420). As a negative control ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were marked with 2,3x10-3 µg/µL 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Thermo Fisher Scientific) for 10 min at RT in the dark ...
-
bioRxiv - Plant Biology 2023Quote: ... 3 µg RNA from each sample was used to mix with 2×RNA loading dye (Thermo Fisher Scientific), denatured at 65℃ for 10 min ...
-
bioRxiv - Genomics 2024Quote: ... Fresh medium was added every 2-3 days and cells were passaged using 1X TrypLE Express (Life Technologies).
-
bioRxiv - Developmental Biology 2022Quote: ... They were then immobilized on glass slides using 2% agarose and injected with 1,1’-dioctadecyl-3,3,3′,3′-tetramethylindocarbocyanine perchlorate (DiI, Molecular Probes) or 3,3′-dioctadecyloxacarbocyanine perchlorate (DiO ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were washed twice with PBS and loaded with 3 µM Fura-2 AM (Thermo Fisher, Waltham, MA) diluted in a modified Krebs-Ringer buffer solution [KRBH ...
-
bioRxiv - Plant Biology 2022Quote: ... equipped with an Acclaim Pepmap C18 trap column (2 cm · 75 µm, particle size: 3 µm; Thermo Fisher) and a C18 analytical column (50 cm · 75 µm ...
-
bioRxiv - Immunology 2022Quote: ... Primary B cells were plated at 2-3×106 cells/ml in primary B cell medium (DMEM (Gibco) containing 10% FBS (Sigma) ...
-
bioRxiv - Biophysics 2023Quote: ... in 3% BSA with a 1:50 ratio and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed ...
-
bioRxiv - Cancer Biology 2023Quote: Cell proliferation was assayed by reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Invitrogen, M6494). MTT was freshly dissolved into PBS at a stock concentration of 12 mM and diluted into phenol red-free DMEM with 10% FBS for a final MTT concentration of 2 mM ...
-
bioRxiv - Biochemistry 2022Quote: ... 2-3 µL of 5 µM protein solution was introduced directly into Q-Exactive UHMR mass spectrometer (ThermoFisher) through gold coated capillary needles that were prepared in-house30 ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins were migrated for 2-3 h at 120 V in NuPAGE MOPS SDS running buffer (#NP0001, Invitrogen) and transferred onto a PVDF membrane (#1704156 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Other PCR products were run on 2 or 3% agarose gels containing Sybr Safe DNA stain (Invitrogen, #S33102) and imaged on a ChemiDoc imager.
-
bioRxiv - Bioengineering 2024Quote: ... Cells were passed every 2-3 days upon reaching ∼80% confluence using 0.05% trypsin-EDTA (Thermo Fisher Scientific) for dissociation.
-
bioRxiv - Biochemistry 2024Quote: ... 2 μl of cDNA were mixed with 3 μl of PowerUp™ SYBR™ Green Master Mix (ThermoFisher) containing 1 μM of forward and reverse primer ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Cell viability was measured with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Thermo Fisher Scientific, M6394). After cell exposure to AG490 and MeHg at specified times and concentrations ...
-
bioRxiv - Bioengineering 2024Quote: ... VSV-G expression plasmid and pUC19 plasmid (2:3:4 ratio by mass) using Lipofectamine 3000 (Thermo Fisher). The media was changed 6 hours post-transfection and was collected for downstream processing 48 hours post-transfection.
-
bioRxiv - Cell Biology 2024Quote: ... The same test was done in parallel to assess the cell viability using MTT at 5 ug/mL (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide) (Invitrogen). Sixteen sites per well were acquired using a 20x Olympus objective plan fluorite NA 0.45 (1320517 ...
-
bioRxiv - Biochemistry 2024Quote: ... and 3 were cleaved from IgGs using Pierce Mouse IgG1 Fab and F(ab’)2 Preparation Kit (ThermoFisher) using protocols provided by the manufacturer ...