Labshake search
Citations for Thermo Fisher :
2901 - 2950 of 10000+ citations for 7 Fluoro 4 hydroxy 3 nitroquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Coverslips were mounted on microscopy slides using 7 µl ProLong Glass Antifade mounting medium (ThermoFisher Scientific, Invitrogen). The mounting medium was cured for 24 h at RT.
-
bioRxiv - Developmental Biology 2023Quote: ... Zebrafish cDNA was prepared from RNA extracted from AB zebrafish (1–7 dpf) using Trizol (Ambion #15596026) and phenol:chloroform (Millipore #19K0856166) ...
-
bioRxiv - Synthetic Biology 2023Quote: Protein thermal stability was measured by differential scanning fluorimetry using a QuantStudio Pro 6/7 (Applied Biosystems). Protein was brought to a concentration of 10 uM with 5x Sypro Orange dye in a final volume of 20 µL in 20 mM NaPi ...
-
bioRxiv - Plant Biology 2023Quote: ... Total RNA from 10 of 7-day-old seedlings was extracted by using TRI reagent (AM9738, Invitrogen). In total ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were resuspended in PBS with 7 μg/ml DAPI and measured on an Attune (Thermo Fisher). Data were analyzed using FlowJo software version 10.7.0.
-
bioRxiv - Plant Biology 2023Quote: ... two guide RNAs targeting the end of exon 6 and the beginning of exon 7 respectively (GAATTCTGCGGCACTATCCA and GATAACAAACTTCTGCTGAC) were designed using CRISPOR (http://crispor.tefor.net/crispor.cgi) and synthesized by Invitrogen GeneArt (ThermoFisher ...
-
bioRxiv - Genetics 2023Quote: ... and fluorescence was monitored on ABI ViiA 7 and QuantStudio 5 Realtime PCR system (Applied Biosystems, USA). Melting curve analysis was done for each amplicon ...
-
bioRxiv - Cell Biology 2023Quote: ... Treated and untreated organoids were collected at day 7 and dissociated to single cells using TrypLE (Invitrogen) incubation at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... MCF-7 and T47D were purchased from ATCC and were cultured in phenol red–free DMEM (Gibco) with 10% FBS ...
-
bioRxiv - Microbiology 2023Quote: ... LLC-MK-2 cells (rhesus monkey kidney; CCL-7/ATCC) were cultured in MEM (GIBCO #11095-080) supplemented with 100 units/ml penicillin and 100 μg/ml streptomycin (P/S) ...
-
bioRxiv - Microbiology 2023Quote: ... using a QuantStudio 7 Flex Real-Time PCR System utilizing TaqMan Gene Expression Master Mix (Applied Biosystems).
-
bioRxiv - Biochemistry 2023Quote: ... and 10% glycerol) using 0.5-mL Zeba™ spin desalting column (7-kDa MWCO) (ThermoFisher Scientific, #89882). The solution was warmed to room temperature and 5 μL of 5 mg/mL taxol-stabilized MTs was added ...
-
bioRxiv - Immunology 2024Quote: ... and qPCR experiments were completed on a QuantStudio 7 flex real-time PCR system (Applied Biosystems, 4485701) using the Taqman gene expression master mix (Applied Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: The brains of 7-day-old flies were dissected in Schneider’s insect medium (Thermo Fisher Scientific, 21720). They were then fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS ...
-
bioRxiv - Physiology 2024Quote: ... in the QuantStudio™ 7 Flex Real-Time PCR System (384-well block, Applied Biosystems, Cat #4485701). 18s rRNA was used as an internal reference control ...
-
bioRxiv - Immunology 2024Quote: ... Relative quantification of genes of interest was performed by qPCR analysis using QuantStudio Pro 7 system (ThermoFisher) and PowerTrack SYBR Green master mix (ThermoFisher) ...
-
bioRxiv - Cell Biology 2024Quote: ... Single cell embedded prostate organoids were supplemented with 10 μM Y-27632 (Fisher Scientific, #50-863-7) for the first 2-3 days in culture prior to change with fresh organoid media lacking Y-27632 ...
-
bioRxiv - Cell Biology 2024Quote: ... Real-time PCR was performed on a QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems) after mixing cDNA ...
-
bioRxiv - Immunology 2024Quote: ... ≈2.5x105 cells were run in each lane of a 7% NuPAGE tris-acetate gel (Invitrogen, Carlsbad, CA) and transferred to Immobilon-FL polyvinylidene difluoride membrane (EMD Millipore ...
-
bioRxiv - Cell Biology 2021Quote: ... PDMPO [2-(4-pyridyl)-5-((4-(2-dimethylaminoethyl-amino-carbamoyl)methoxy)-phenyl)oxazole] (ThermoFisher Scientific, USA) was added to a final concentration of 330 µM ...
-
bioRxiv - Microbiology 2022Quote: ... interleukin-10 (IL-10) and interleukin-4 (IL-4) levels by sandwich ELISA kits (ThermoFisher Scientific). The measurement from unstimulated splenocytes (incubated with medium only ...
-
bioRxiv - Immunology 2021Quote: ... 4°C) and cells were spun onto glass slides using a Cytospin 4 Cytocentrifuge (Thermo Scientific), dried for 10 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were migrated on precast Novex 4–20% or 4–12% polyacrylamide gels (Thermo Fisher Scientific), then transferred to Novex nitrocellulose membranes (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... and then fixed overnight at 4°C in 4% paraformaldehyde (Alfa Aesar, Thermo Fisher Scientific, UK), followed by several washes in 0.1M Phosphate buffered saline (PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... only 4 μL of 1 mM FM 4-64 (Cat. number T13320, Thermo Fisher, Waltham, MA) was injected ...
-
bioRxiv - Biochemistry 2022Quote: ... samples were run on Bolt 4–12% SDS-polyacrylamide and native-PAGE 4-16% gels (Invitrogen) respectively ...
-
bioRxiv - Biochemistry 2024Quote: ... samples were run on Bolt 4–12% SDS-polyacrylamide and native PAGE 4-16% gels (Invitrogen) respectively ...
-
bioRxiv - Cell Biology 2023Quote: ... diluted in fresh DMEM for 4 h followed by fixation with 4% PFA (Thermo Fisher Scientific). To induce expression of the hGRAD and TRIM21 systems ...
-
bioRxiv - Physiology 2023Quote: ... 0.5 mg protein was precleared for 30 minutes at 4°C with 4% Agarose beads (ThermoFisher). To immunoprecipitate RYR1 ...
-
bioRxiv - Systems Biology 2024Quote: ... A Dionex IonPac AS11-HC-4 µm column (250 × 0.4 mm, 4 µm; Thermo Fisher Scientific) was used at 35°C to separate metabolite ...
-
bioRxiv - Biophysics 2020Quote: ... 4 mM glutamine GlutaMAX™ (Gibco) and 1x non-essential amino acids (Gibco) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 mM L-glutamine (Life Technologies), 1 mM sodium pyruvate (Life Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 μL of Lipofectin (Life Technologies) and 1 μg of plasmid ...
-
bioRxiv - Cell Biology 2020Quote: ... Isopropanol (Thermo Fisher Scientific - A416-4), LDL (Alfa Aesar - J65039) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 4% FBS (10042682; Fisher Scientific) (Placzek et al. ...
-
bioRxiv - Immunology 2021Quote: ... and 4 units of RNaseOUT (ThermoFisher). Following sorting ...
-
bioRxiv - Bioengineering 2019Quote: ... 4 mM L-glutamine (Life Technologies), 10 mM HEPES (Sigma ...
-
bioRxiv - Cancer Biology 2019Quote: ... 100ng/ml IL-4 (Gibco, USA) for 48h ...
-
bioRxiv - Neuroscience 2019Quote: ... and 4-12% NuPAGE (Thermo Scientific) Bis-Tris gels for ECC proteins ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 nM Calyculin A (PHZ1044; Invitrogen) or 1 mM 4-hydroxyacetophenone (278564 ...
-
bioRxiv - Developmental Biology 2021Quote: ... on the Qubit 4 fluorometer (Invitrogen). RNA quality was assessed using the RNA 6000 Nano kit total RNA assay (Agilent ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 ng/ml IL-4 (Gibco), 10 ng/ml IL-10 (Gibco) ...
-
bioRxiv - Bioengineering 2021Quote: ... in 4% horse serum (ThermoFisher, 16050122) and then incubated overnight with primary antibodies in 4% horse serum at 4 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 mM Glutamax (Thermo Fisher Scientific) and 1% v/v antibiotics/antimycotics (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2021Quote: ... separated on 4%-12% NuPAGE (Invitrogen), and then electroblotted onto a polyvinylidenedifluoride membrane ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 4% horse serum (Gibco), 1% CEE and 1% (v/v ...
-
bioRxiv - Neuroscience 2020Quote: Fluo-4 AM (Thermo Fisher Scientific), a Ca2+ indicator ...
-
bioRxiv - Physiology 2021Quote: ... 4 μL Tween 80 (Fisher Scientific), 20 μL cremaphor (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... 4-chlorobenzenesulfonate salt (DiD) (Life Technologies), as described before (12) ...
-
bioRxiv - Microbiology 2019Quote: ... fixed with 4% formaldehyde (Thermo Fisher) in PBS and permeabilized with 70% ethanol ...