Labshake search
Citations for Thermo Fisher :
2851 - 2900 of 10000+ citations for Mouse Anti Japanese Encephalitis Virus NS1 Antibody JA12 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... antibodies were used followed by specific secondary Alexa Fluor antibodies (1:500 anti-mouse Alexa Fluor 546 and 1:500 anti-rabbit Alexa 488 Thermo Fisher). For actin staining ...
-
bioRxiv - Developmental Biology 2023Quote: ... The secondary antibodies Alexa 488-conjugated goat anti-mouse and Alexa-568-conjugated goat anti-rabbit (Molecular Probes, Waltham, MA, USA) were diluted 1:400 and 1:1000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... slides were incubated 45-60 min at room temperature with secondary antibodies in PBT (1:500 goat anti-rabbit-Alexa488 and goat anti-mouse-Alexa568 (ThermoFisher Scientific). Slides were counterstained with 1 μg/ml Hoechst 33258 (Sigma ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cells were then washed with cold 1X PBS three times for 3 min each and incubated with Alexa 555-labeled anti-rabbit and Alexa 488-labeled anti-mouse secondary antibody (Thermo Fisher) at room temperature for 1 hour ...
-
bioRxiv - Immunology 2023Quote: ... Anti-CD19 CAR was detected using an anti-idiotype antibody specific for the HD37 aCD19 binder (in-house) and Goat anti-Mouse IgG2a secondary – AF647 (Invitrogen; A21241).
-
bioRxiv - Molecular Biology 2023Quote: ... with AF488-conjiugated secondary antibodies diluted 1:3000 in BPS (goat anti-mouse IgG, A11001 or goat anti-rabbit IgG, A11008, Life Technologies). For dual-color IF ...
-
bioRxiv - Genomics 2023Quote: ... washed with 1XPBS then incubated for 40 min at RT with Alexa Fluor 488 nm anti-rabbit or Alexa Fluor 594 nm anti-mouse secondary antibodies (Life Technologies). Cells were then washed in 1XPBS and mounted in Vectashield plus DAPI (Vector Laboratories) ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were incubated for 40 min at RT with Alexa Fluor 488 nm anti-rabbit or Alexa Fluor 594 nm anti-mouse secondary antibodies (Life Technologies). Finally ...
-
bioRxiv - Microbiology 2023Quote: ... the cells were incubated for 1 h at RT with the secondary antibodies: goat anti-rabbit immunoglobulin G (IgG) Alexa Fluor 488 and/or goat anti-mouse IgG Alexa Fluor 594 (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:10, anti-mouse Minus-probe, 1:10, and anti-chicken Alexa Plus 647-secondary antibody, 1:1,000, Thermo Fisher Scientific) at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... Membranes were washed in PBS-T and incubated with fluorescent secondary antibody (anti-mouse or anti-rabbit conjugated to AlexaFluor488 or 647, both Life Technologies) for 2-3h at RT ...
-
bioRxiv - Neuroscience 2023Quote: ... and then incubated with secondary antibody (AlexaFluor 546 donkey anti-mouse for PV, goat anti-rabbit for GluR2/3 or NPY, both 1:400, Thermo Fisher). Secondary antibody was dissolved in 1% normal donkey serum for PV or 1% normal goat serum for GluR2/3 or NPY ...
-
bioRxiv - Cell Biology 2023Quote: ... using Alexa fluor 488 (A488) or Alexa fluor 647 (A647) conjugated goat anti-mouse IgG or goat anti-rabbit IgG antibodies (Thermo Fisher Scientific ...
-
Treg cells drive MYCN-mediated immunosuppression and tumor aggressiveness in high-risk neuroblastomabioRxiv - Cancer Biology 2023Quote: ... Secondary antibodies included horseradish-peroxidase-conjugated anti-mouse or anti-rabbit IgG (1:2000 or 1:5000; ThermoFisher, 31430 or 31460). Proteins were detected by ECL chemiluminescence detection kits (ThermoFisher ...
-
bioRxiv - Genetics 2023Quote: ... the sections were washed three times with PBS 1X and then incubated for 1 hour with donkey anti-mouse (or anti-rabbit) Alexa Fluor 488nm (or 555nm) secondary antibodies (1:200, Thermofisher Scientific). DAPI (Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... The donkey anti-mouse IgG AlexaFluor 564 and donkey anti-chicken AlexaFluor 488 antibodies were purchased from Life Technologies (Carlsbad, CA).
-
bioRxiv - Biophysics 2024Quote: ... secondary antibodies donkey anti-rabbit IgG and donkey anti-mouse IgG conjugated with Alexa Fluor 488 and 647 (Thermo Fisher Scientific), respectively ...
-
bioRxiv - Cell Biology 2019Quote: ... Anti-rabbit or -mouse Alexa 488 and anti-mouse or -rabbit Alexa 568 (Invitrogen) secondary antibodies were used at a 1:250 dilution ...
-
bioRxiv - Molecular Biology 2020Quote: ... Secondary antibody incubation was for 1 hour at room temperature using HRP conjugated antibodies: anti-mouse IgG at 1:3000(Invitrogen 62–6520) or goat anti-rabbit IgG at 1:3000 (Promega W4011) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Then coverslips were inverted onto 100 μL of antibody block with secondary antibodies (Alexa Fluor 488 anti-mouse - 1:200, Life Technologies #A11029) and DAPI (DNA ...
-
bioRxiv - Biochemistry 2020Quote: ... washed three times with PBS and added with the secondary antibody (Alexa Fluor 488 Conjugated anti-mouse antibody, Life technologies by ThermoFisher Scientific) at 1:250 for overnight at 4 °C ...
-
bioRxiv - Cell Biology 2020Quote: GFP was visualized using rabbit polyclonal or mouse monoclonal anti-GFP primary antibodies and Alexa 647-labelled secondary antibodies (Molecular Probes/Invitrogen) directed against rabbit or mouse ...
-
bioRxiv - Molecular Biology 2021Quote: ... the samples were washed with PBS and incubated in the dark for 1 h at 4 °C with secondary antibody (Alexa Fluor-568-conjugated anti-mouse antibody, 1:750, Thermo Fisher Scientific). Finally ...
-
bioRxiv - Microbiology 2019Quote: ... fixed in 4% paraformaldehyde and stained with a primary mouse monoclonal antibody raised against IBDV VP2 [18] and a secondary goat anti-mouse antibody conjugated to Alexa Fluor 488 (Thermo Fisher Scientific). Wells were marked positive or negative for the presence or absence of virus by immunofluorescence microscopy and the TCID50/mL calculated by the Reed and Muench method [19] ...
-
bioRxiv - Neuroscience 2020Quote: ... Secondary antibody solution contained 2 secondary antibodies in blocking solution: Goat anti-mouse Alexa-Flour (AF) 568 (Invitrogen A-11004, 1:400), Goat anti-chicken AF-488 (Invitrogen A11039 ...
-
bioRxiv - Microbiology 2021Quote: ... cells were fixed with 4% PFA for 30 minutes and stained for intracellular ENV with 1A1D-2 (1/500) monoclonal antibody and anti-mouse 647-conjugated antibody (2 μg/ml, Invitrogen Cat# A21235).
-
bioRxiv - Microbiology 2022Quote: ... Bound primary antibody was then labeled for 1h at room temperature using Alexa488 goat anti-mouse IgG secondary antibody (Invitrogen, OR, USA) at a 1:750 dilution in PBS ...
-
Purkinje cardiomyocytes of the ventricular conduction system are highly diploid but not regenerativebioRxiv - Developmental Biology 2022Quote: ... heart tissue sections were incubated at room temperature for 2 hr with secondary antibodies: goat anti-mouse IgG (H+L) cross-adsorbed secondary antibody AlexaFluor 488 conjugate 1:500 (A11001, Thermo Fisher Scientific); goat anti-rabbit IgG (H+L ...
-
bioRxiv - Cell Biology 2019Quote: ... and then incubated at room temperature for 1 hour in secondary antibody solution which contained Alexa 488-conjugated anti-mouse antibody (1:200; Thermo Fisher Scientific), rhodamine phalloidin (1:50 ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were then stained with M2 FLAG primary antibody (SigmaAldrich, F1804) and AlexFluor 594-conjugated anti-mouse goat antibody (ThermoFisher, A-11005) using the same conditions ...
-
bioRxiv - Cell Biology 2019Quote: ... Binding of the primary antibody was detected by incubation with Alexa Fluor 488-conjugated goat anti-mouse or secondary antibody (Invitrogen Molecular Probes). The sexual stages were highlighted by double-labelling with rabbit antibodies directed against Pfs230 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The primary antibody was then detected by an Alexa Fluor™ 488-conjugated goat anti-mouse secondary antibody (Invitrogen, Cat# A-11001), which was diluted 1:500 in blocking solution (PBS containing 1% FCS [Bioconcept ...
-
bioRxiv - Neuroscience 2023Quote: ... The secondary antibodies used were Alexa Fluor 633-conjugated goat anti-mouse antibody (Cat No. A-21050, 1:200, Thermo Fisher Scientific) and Alexa Fluor 488-conjugated goat anti-rabbit antibody (Cat No ...
-
bioRxiv - Cancer Biology 2022Quote: ... coverslips were inverted onto 100 μl of antibody block with secondary antibodies (Alexa Fluor 488 anti-mouse, 1:200, A11029; Thermo Fisher Scientific) and DAPI (DNA ...
-
bioRxiv - Systems Biology 2024Quote: Xenopus immunostaining was carried out as previously described102 with a primary antibody against beta-tubulin (1:100, DSHB E7) and a secondary goat anti-mouse fluorescent antibody (1:250, Life Technologies A32723).
-
bioRxiv - Cancer Biology 2023Quote: ... 1μl of sample was mixed in 20μl final of SoFast-Green reaction mix containing 10nM of forward (CCGTCTTAAGTTTGATTTT) and reverse (AGAGGTGGACCAACTCGGTA) primers for MVMp NS1 gene amplification using the StepOnePlus real-time PCR system (Thermo Fisher Scientific). Primers targeting the 18S gene were used for normalization (forward ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-©tubulin (mouse monoclonal, MilliporeSigma T6557, 1:200) and mouse anti-ZO-1 (Life Technologies, 1:300). Rabbit anti-Pard3 (rabbit polyclonal ...
-
bioRxiv - Microbiology 2020Quote: ... and mouse anti-Actin (Invitrogen) at 1:3000 in 2% Bovine Serum Albumin (BSA) ...
-
bioRxiv - Bioengineering 2020Quote: ... mouse anti-PGK1 monoclonal (Invitrogen)) at 4°C overnight ...
-
bioRxiv - Developmental Biology 2021Quote: ... mouse anti-GAPDH (ThermoFisher AM4300), rabbit anti-Sra-1 (1/1000 ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-V5 (Thermo Fisher Scientific Cat# R960-25 ...
-
bioRxiv - Cell Biology 2020Quote: ... goat anti-mouse 680 (Invitrogen), goat anti-rabbit 800 (Invitrogen).
-
bioRxiv - Genomics 2022Quote: ... goat anti-mouse (Invitrogen #G21040), goat anti-rabbit (Invitrogen #G21234).
-
bioRxiv - Molecular Biology 2020Quote: ... mouse monoclonal anti-V5 (Invitrogen R960-25 ...
-
bioRxiv - Molecular Biology 2021Quote: ... anti-mouse Alexa 594 (Invitrogen), at 1:200 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse-anti V5 (Invitrogen, R96025). Donkey anti-rabbit Alexa 568 (1:500 ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-GAPDH (Invitrogen, AM4300), mouse anti-β-actin (Proteintech ...
-
bioRxiv - Cell Biology 2019Quote: ... anti-mouse-HRP (1;10,000; Invitrogen), and anti-chicken-HRP (1:20,000 ...
-
bioRxiv - Genetics 2020Quote: ... donkey anti-mouse (Invitrogen A21203), rabbit anti-guinea pig (ThermoFisher PA1-28595).
-
bioRxiv - Neuroscience 2019Quote: ... mouse anti-Golgin 97 (ThermoFisher), 1μg/ml ...