Labshake search
Citations for Thermo Fisher :
2851 - 2900 of 10000+ citations for Fatty acid binding protein FABP1 Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... 0.8 mM KH2PO4, 20 mM NaHCO3, 1.3 mM L-glutamine, 0.2 mM ascorbic acid, MEM amino acids solution [Gibco; Thermo Fisher, Waltham ...
-
bioRxiv - Cancer Biology 2022Quote: ... was used for essential amino acid (EAA) mix and 1X MEM Non-Essential Amino Acids Solution (Gibco, Cat. #11140050) was used for non-essential amino acid (NEAA ...
-
bioRxiv - Molecular Biology 2022Quote: ... C18 disk were washed 10 times with LC-MS grade water containing 0.1 % formic acid and subsequently eluted with 80% acetonitrile/0.1% formic acid and dried using a Speedvac (Thermo Scientific). Peptides were quantified with Quantitative Colorimetric Peptide Assay (Thermo Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... A 300 μL solution of 5% formic acid and 0.2% trifluoroacetic acid (TFA) R2 50 μm Poros (Applied Biosystems) beads slurry in water was added to the gel pieces before returning the samples to the shaker for an additional three hours at 4°C ...
-
bioRxiv - Plant Biology 2022Quote: ... formic acid and trifluoroacetic acid (TFA) were liquid chromatography-mass spectrometry (LC-MS) grade solvents (Thermo Fisher Scientific, US). Ethanol was analytical grade (Chem-Supply ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.8 mM KH2PO4, 20 mM NaHCO3, 1.3 mM L-glutamine, 0.2 mM ascorbic acid, MEM amino acids solution [Thermo Fisher] ...
-
Shear stress and very low levels of ligand synergize to activate ALK1 signaling in endothelial cellsbioRxiv - Cell Biology 2023Quote: ... amino acids 23-429) or pro- BMP10 (NP_055297.1, amino acids 22-424) was cloned into pcDNA3.1+ (Invitrogen/Thermo Fisher Scientific) downstream of the rat serum albumin signal peptide ...
-
bioRxiv - Immunology 2024Quote: ... and 1 mM Ethylenediaminetetraacetic acid [EDTA]) containing 0.01% MilliporeSigma™ GelRed™ Nucleic Acid Stain (Fisher Scientific, catalog # SCT123) with electrophoresis performed at 65V for 1 hour to detect the 230 bp transgene amplicon ...
-
bioRxiv - Genetics 2024Quote: ... and 1 mM Ethylenediaminetetraacetic acid [EDTA]) containing 0.01% MilliporeSigma™ GelRed™ Nucleic Acid Stain (Fisher Scientific, catalog # SCT123) with electrophoresis performed at 200V for 30 minutes to detect the 604 bp transgene amplicon ...
-
bioRxiv - Microbiology 2022Quote: Nucleic acid extraction was carried out using the MagMAX CORE Nucleic Acid Purification Kit (Applied Biosystems, Thermo Fisher Scientific). A pre-treatment step using bead beating tubes from MagMAX CORE Mechanical Lysis Module was introduced to improve DNA recovery ...
-
bioRxiv - Microbiology 2022Quote: Nucleic acid extraction was carried out using the MagMAX CORE Nucleic Acid Purification Kit (Applied Biosystems, Thermo Fisher Scientific). A pre-treatment step using bead beating tubes from MagMAX CORE Mechanical Lysis Module was introduced to improve DNA recovery ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5% acetic acid) and solvent B (80% acetonitrile, 0.5% acetic acid) into an Orbitrap Eclipse mass spectrometer (Thermo Scientific). High resolution full MS spectra were acquired with a resolution of 120,000 ...
-
bioRxiv - Cell Biology 2021Quote: Primary human vein endothelial cells (HUVECs) were cultured in human endothelial SFM medium (Invitrogen) containing 20% foetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Human CD4+ T cells were activated by Dynabeads Human T-Activator CD3/CD28 (ThermoFisher) and cultured in AIMV medium (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... + 2% human serum albumin (ThermoFisher) + 5 μM ROCKi (Tocris) ...
-
bioRxiv - Cell Biology 2020Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knock down GR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... including human 293FT cells (Invitrogen), rat2 cells (ATCC #CRL-1764) ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Genetics 2019Quote: ... human COT-1 DNA (Invitrogen) and biotin-labeled mouse COT-1 or minor satellite DNA (a gift from Dr ...
-
bioRxiv - Genetics 2021Quote: ... human COT-1 DNA (ThermoFisher) to detect HSA21 and biotin-labeled I-EGFP-I-loxP-3’HPRT (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... recombinant human Vitronectin (Gibco A14700) was used at a final concentration of 25ug/ml ...
-
bioRxiv - Cancer Biology 2020Quote: Human recombinant IL-1β (ThermoFisher) was reconstituted in deionised water and administered at 10 ng/ml.
-
bioRxiv - Cell Biology 2021Quote: ... human FMR1 (Ambion, USA, 4392420) and human ATF4 (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... AlexaFluor633 anti-human (all ThermoFisher) used 1:2000 in PBS with 0.2% BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human CD11b-APC (Thermo Fisher); Human CD34-PE (Miltenyi Biotec);and Human CD33-APC-Cy7 (Abcam).
-
bioRxiv - Microbiology 2020Quote: ... and anti-human SPIB (Invitrogen) antibodies by incubating for 45 minutes at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: Human epidermal keratinocytes (HEKs, Thermofisher), and patient keratinocytes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human Epidermal Melanocyte cells (Invitrogen) were cultured in Medium 254 (Invirogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... and recombinant human FGF2 (Invitrogen) at 20 ng/ml ...
-
bioRxiv - Immunology 2021Quote: Human iPS cells (Thermo Fisher) were cultured on vitronectin-coated T225cm2 flasks using complete mTesSR Plus medium (StemCell Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... human COT1 DNA (Invitrogen, 15279011) and Vysis CEP hybridization buffer (Abbott Molecular ...
-
bioRxiv - Immunology 2020Quote: ... Human Expi293 cells (Thermo Scientific) were transfected with these constructs using FectoPro (PolyPlus Transfection ...
-
bioRxiv - Neuroscience 2021Quote: Human iPSCs (Thermo Fisher #A18945) were maintained in mTeSR1 medium (StemCell ...
-
bioRxiv - Immunology 2022Quote: ... APRIL Human ELISA Kit (ThermoFisher) and Human CD83 DuoSet ELISA Kit (R&D systems) ...
-
bioRxiv - Neuroscience 2022Quote: ... and human ACTB (Thermofisher Hs01060665_g1). For other qPCRs ...
-
bioRxiv - Microbiology 2023Quote: ... human Gas6 (Invitrogen, cat# BMS2291), mouse Axl (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... Human primary astrocytes (ThermoFisher #N7805200) were maintained as described in user manual ...
-
bioRxiv - Molecular Biology 2024Quote: ... human COT1 DNA (#15279011, Invitrogen) and 3 volumes of ethanol (#10000652 ...
-
bioRxiv - Immunology 2024Quote: ... or anti-human (Invitrogen #A11013) secondary antibodies at 20 μg/mL in PBS/2% BSA for 30 min ...
-
bioRxiv - Systems Biology 2023Quote: ... and human IgE-PE (ThermoFisher). Antibody details are shown in Table S4 ...
-
bioRxiv - Genomics 2023Quote: ... human p53 (Invitrogen, PA5-27822), MDM2 (Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2023Quote: ... human IFN-gamma ELISA (Invitrogen) and granzyme B ELISA (R&D Systems ...
-
bioRxiv - Physiology 2023Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knockdown GR ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD235a (#17998742, Invitrogen), anti-human CD326 (EpCAM ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD45 (#17945942, Invitrogen), anti-human CD235a (#17998742 ...
-
bioRxiv - Cell Biology 2023Quote: ... Human Cot-1 DNA (Invitrogen), 3M NaAc and 100% cold EtOH ...
-
bioRxiv - Cancer Biology 2024Quote: Recombinant human EGF (Gibco #PHG0311) was added to the medium of NCI-H23 or H23 KO cells at 80% confluency to reach a final concentration of 100 ng/mL ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human Pool Set v3.0 (Thermofisher) and TaqMan™ MicroRNA Reverse Transcription Kit (Thermofisher) ...