Labshake search
Citations for Thermo Fisher :
2851 - 2900 of 10000+ citations for Biotin Z Antibody Internalization Kit rabbit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2020Quote: ... Secondary antibody at a 1/1000 dilution (Alexa Fluor 594 goat anti-rabbit antibody or Alexa Fluor 488 goat anti-mouse antibody, Thermo Fisher) in blocking buffer also containing Alexa Fluor-405 phalloidin (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: GFP was visualized using rabbit polyclonal or mouse monoclonal anti-GFP primary antibodies and Alexa 647-labelled secondary antibodies (Molecular Probes/Invitrogen) directed against rabbit or mouse ...
-
bioRxiv - Physiology 2021Quote: ... Alex Fluor 546 donkey anti-rabbit secondary antibodies and Alex Fluor 647 goat anti-rat secondary antibodies (1:500; Molecular Probes) for 1 hour at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... an anti-P2X3 antibody (1:1000, Alomone APR016, anti-rabbit polyclonal) and an Alexa-488 conjugated secondary antibody (1:1000, Invitrogen A21206). The mean gray value of each DRG neuron was measured in ImageJ and a custom-made R toolkit (https://github.com/amapruns/Immunohistochemistry_Analysis ...
-
bioRxiv - Microbiology 2020Quote: ... Fluorescently conjugated secondary monoclonal antibodies (Alexa Fluor 488 and 555 conjugated antibody series against mouse, rabbit, or goat from Life Technologies) were used for detection ...
-
bioRxiv - Immunology 2020Quote: ... Primary antibody labeling was followed by labeling with anti-mouse-AlexaFluor-647 and anti-rabbit-AlexaFluor-555 secondary antibodies (Life Technologies). Flow cytometry data was collected using a FACSCanto II flow cytometer (BD Biosciences) ...
-
bioRxiv - Biochemistry 2022Quote: ... or monoclonal mouse antibodies directed against TBEV E [21] and conjugated secondary antibodies anti-rabbit Alexa555 (1:500, Thermo Fisher Scientific). Nuclei were counterstained with DAPI ...
-
bioRxiv - Neuroscience 2022Quote: ... Primary antibodies were paired with goat anti-mouse and goat anti-rabbit secondary antibodies conjugated to Alexa Fluor 488 (Thermo Fisher A-21121 ...
-
bioRxiv - Microbiology 2024Quote: ... coverslips were washed three times for 10 min in PBS and subsequently incubated with the secondary antibody goat anti-rabbit alexa-488 antibody (Thermo Fisher/Invitrogen) (1:300) ...
-
bioRxiv - Plant Biology 2024Quote: ... as the primary antibody at 1:100 dilution and donkey anti-rabbit AlexaFluor 555 antibodies (A31572, Thermo Fisher Scientific, Waltham, MA) as the secondary antibody at 1:1000 dilution ...
-
bioRxiv - Microbiology 2024Quote: ... a rabbit anti-GFP antibody (1:2000, Yeasen Biotechnology Co., Ltd) and a Mouse anti-β-actin antibody (1:2000, Invitrogen) were added and incubated at 4°C overnight ...
-
bioRxiv - Microbiology 2024Quote: ... The parasites were washed three times for 5 min in 1 x PBS before the second antibody (Alexa Fluor 647-conjugated goat anti-Rabbit antibody (Life Technologies)) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:600) antibody was incubated at 4°C overnight followed by secondary antibody anti-rabbit Alexa 488 (ThermoFisher Scientific, 1:600) for 1h at RT ...
-
bioRxiv - Immunology 2024Quote: ... 1:500) antibodies, Alexa Fluor 546 goat anti-rabbit (#A11035, 1:500) antibodies and Hoechst 33342 (#H3570, 1:1000) from Thermo Fisher Scientific (USA) ...
-
bioRxiv - Biochemistry 2023Quote: ... followed by staining with secondary anti-Rabbit antibodies (1:500) conjugated to Alexa Fluor 555 (Goat anti-Rabbit IgG, Superclonal Recombinant Secondary Antibody, Alexa Fluor 555, Thermofisher, # A27039) for 30 minutes on a shaker at Room temperature ...
-
bioRxiv - Bioengineering 2024Quote: ... was used as a primary antibody with a goat anti-rabbit secondary antibody conjugated to either Alexa Fluor 488 or 633 (1:500, Thermo Scientific). The anti-Cx43 antibody targets the C-terminal domain and will therefore identify both full-length Cx43 and GJA1-20k ...
-
bioRxiv - Microbiology 2023Quote: ... probed with antibodies against different targets followed by HRP-conjugated anti-mouse or anti-rabbit IgG secondary antibodies (Thermo Fisher Scientific), and then the protein bands were visualized using enhanced chemiluminescent (ECL ...
-
bioRxiv - Microbiology 2023Quote: ... Visualization of the primary antibody was performed using HRP-conjugated goat anti-rabbit secondary antibody (Thermo Scientific #31460; 1:10,000 dilution) or HRP-conjugated goat anti-mouse secondary antibody (Thermo scientific #31430 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Detection of all other primary antibodies was performed using goat anti-rabbit Poly HRP secondary antibody (Invitrogen B40962; 10 min incubation). The HRP-conjugated secondary antibody polymer was detected using fluorescent tyramide signal amplification using Opal dyes 520 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Then the samples underwent phosphate buffered saline (PBS) washing for 15min before incubated with the second antibody HRP goat anti-rabbit antibody (ThermoFisher, 31460) which was dissolved into 1% BSA for 1h in room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... incubated overnight with primary antibodies at 4 degrees and detected with goat anti-rabbit or mouse-HRP secondary antibodies (Thermo Scientific) followed by detection using SuperSignal™ West Pico Plus chemiluminescent substrate (Thermo Scientific).
-
bioRxiv - Cancer Biology 2023Quote: ... they were incubated in secondary antibody conjugated to different fluorophores (Alexa 555-labeled anti-rabbit and Alexa 488-labeled anti-mouse secondary antibody (Thermo Fisher)) and DAPI for 1 hour at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were then incubated overnight with rabbit anti-p-ERM primary antibody (1:5000, Roubinet, 2011) followed by goat anti-rabbit Alexa Fluor 488-conjugated secondary antibody (1:200, Invitrogen #A11070) for 1h ...
-
bioRxiv - Biochemistry 2023Quote: ... Horseradish peroxidase-conjugated secondary antibodies against rabbit (catalogue number: 31460) and mouse IgG (catalogue number: 31430) were Pierce antibodies from Thermo Scientific. Adenosine-5’-Triphosphate (ATP) ...
-
bioRxiv - Cell Biology 2023Quote: ... The blot was then incubated with a secondary antibody: goat anti-rabbit IgG (H+L) antibody (1:5000; Thermo Fisher Scientific) or Goat anti-mouse IgG (H+L ...
-
bioRxiv - Bioengineering 2023Quote: ... the samples were left to incubated at room temperature for 90 minutes with the corresponding secondary antibodies (diluted 1:200 in PBS): Alexa Fluor® 488 Goat Anti-Rabbit IgG Antibody (Product #A-11008, Invitrogen) and Anti-Mouse IgG Secondary Antibody ...
-
bioRxiv - Immunology 2023Quote: ... transferred to nitrocellulose membranes and the membranes were probed with the following antibodies: a rabbit anti-MAVS polyclonal antibody (Thermo Fisher), a rabbit anti-STING polyclonal antibody (Cell Signaling) ...
-
bioRxiv - Neuroscience 2023Quote: ... membranes were washed and then incubated with the corresponding secondary antibodies for 1h at room temperature (Goat Anti-rabbit Secondary Antibody, HRP conjugate 1:1000, ThermoFisher #31460). All antibodies were diluted in a 5% BSA solution in TBS-T ...
-
bioRxiv - Microbiology 2024Quote: ... Rabbit anti-BAG1 primary antibodies (1:1000; Carruthers Lab) and goat anti-rabbit Alexa Fluor 594 secondary antibodies (1:1000; Invitrogen; #A11012) were utilized ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1:500 anti-Mouse IgG-HRP-linked whole ab sheep antibody (Cytiva NA931V) and 1:500 anti-rabbit IgG-Alexa 488-conjugated donkey antibody (Invitrogen A21206), (2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1:500 anti-Mouse IgG-HRP-linked whole ab sheep antibody (Cytiva NA931V) and 1:500 anti-rabbit IgG-Alexa 647-conjugated donkey antibody (Invitrogen A31573). Washed three times for 30 minutes each in TNTT at 4 ℃ to remove secondary antibodies ...
-
bioRxiv - Immunology 2024Quote: ... Chemiluminescence was used to detect the secondary antibody (Anti-rabbit IgG, HRP-linked Antibody #7074 and SuperSignal™ West Pico PLUS Chemiluminescent Substrate, ThermoFisher).
-
bioRxiv - Systems Biology 2020Quote: ... SiteClick R-PE Antibody Labeling Kit (Life Technologies S10467) was used to conjugate the antibodies with 10-20 equivalent of 5’ DBCO-modified 18-nt DNA oligonucleotides (IDT) ...
-
bioRxiv - Molecular Biology 2022Quote: ... were prepared using the Apex Antibody Labelling Kit (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2021Quote: ... SiteClick R-PE Antibody Labeling Kit (Life Technologies S10467) was also used to crosslink 5’ DBCO-modified 18-nt DNA oligonucleotides (Integrated DNA Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... using the antibody coupling kit (#14311D, Thermo Fisher Scientific). Cells cultured in triplicate were lysed in 1% CHAPSO IP lysis buffer (50 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2022Quote: ... using the dynabeads™ Antibody Coupling Kit (Invitrogen, USA) according to the manufacturer’s instructions.
-
bioRxiv - Bioengineering 2023Quote: Site-click Qdot 655 antibody labeling kit (Invitrogen, S10453) was used to separately conjugate an anti-tau antibody (Tau-5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Pierce antibody biotinylation Kit (90407) was purchased from ThermoFisher. Nitrocellulose membrane was purchased from Cytiva (Catalog no ...
-
bioRxiv - Molecular Biology 2019Quote: ... The antibody was coupled to magnetic beads using the Dynabeads antibody coupling kit (Invitrogen, USA) following the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... The acetylated tubulin antibody was conjugated with Pacific Blue Antibody Labelling Kit (Thermo Fisher Scientific) prior to use ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Centromeric repeat probes were amplified by PCR using Biotin-11-dUTP (Thermofisher) with primer TCTAGCACTTGTAATCAATCAAATTC and AGAAGTGAGAAGAAAGACTTG ...
-
bioRxiv - Bioengineering 2019Quote: ... followed by incubation with Isolectin-B4(IB4)-biotin (5 µg/ml, Invitrogen) for 24 h at 4 °C in TBS ...
-
bioRxiv - Biochemistry 2019Quote: Biotin pull-down assays were performed using streptavidin-conjugated agarose (Thermo Fisher) in 20 mM HEPES buffer ...
-
bioRxiv - Biophysics 2021Quote: ... 50 μl of 20 pM double biotin-labelled λDNA (ThermoFisher Scientific; SD0011) was introduced into flow cells at 1 ~ 2 μl/min in the T50 buffer with 200 nM Sytox orange (ThermoFisher Scientific ...
-
bioRxiv - Bioengineering 2020Quote: ... EZ-Link amine-PEG2-biotin and neutravidin protein was purchased from ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... and biotin-tagged DNA was pulled down with streptavidin beads (Invitrogen, 65001) and ligated with Illumina paired-end adapters ...
-
bioRxiv - Biophysics 2021Quote: ... Protein was labeled with maleimide-activated biotin-PEG11 (EZ-Link, ThermoFisher Scientific) in the presence of N-ethylmaleimide (NEM ...
-
bioRxiv - Immunology 2021Quote: ... MERTK & CD68 stains were done sequentially with biotin-avidin blocking (Life Technologies) between stains ...
-
bioRxiv - Cancer Biology 2021Quote: ... Biotin-marked ligation junctions were immobilised using MyOne Streptavidin C1 Dynabeads (Invitrogen) in binding buffer (5 mM Tris-HCl pH 8.0 ...