Labshake search
Citations for Thermo Fisher :
2851 - 2900 of 10000+ citations for 5 NITROFURFURYL ALCOHOL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... 5 μl of SUPERase-In RNAse inhibitor (Ambion™ #AM2694) was added to the reaction ...
-
bioRxiv - Immunology 2019Quote: ... 2 µL of the primer mix (5 mM dNTP [Invitrogen] ...
-
bioRxiv - Physiology 2019Quote: ... at a final SYTOX Red concentration 5 nM (ThermoFisher, S34859). High- and low-fluorescence cells were sorted on a fluorescence-activated Influx cell sorter (BD Influx system) ...
-
bioRxiv - Bioengineering 2019Quote: ... to free carboxyl groups and 5 mM Sulfo-NHS (ThermoFisher). The solution was mixed periodically during the incubation period using a chilled 1cc syringe ...
-
bioRxiv - Neuroscience 2019Quote: ... incubation for 3-5’ in 3,3’ diaminobenzidine (DAB, Acros Organics) staining solution (0.025% w/v DAB ...
-
bioRxiv - Systems Biology 2020Quote: ... 5 μL of 20 mg/mL proteinase K (AM2548, Invitrogen) was added to the cells in lysis buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 5 µg of human Cot-1 DNA (ThermoFisher Scientific) and then denatured in deionized formamide (Merck ...
-
bioRxiv - Genetics 2019Quote: ... or 1 mg/ml 5-fluoroorotic acid (R0812, Thermo Fisher).
-
bioRxiv - Molecular Biology 2019Quote: ... 5′ capping (mMESSAGE mMACHINE™ T7 Transcription Kit, Thermo Fisher), and 3′ poly(A ...
-
bioRxiv - Microbiology 2019Quote: ... supplemented to contain 5% fetal bovine serum (FBS) (Life Technologies), and 2 mM L-glutamine (Invitrogen) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 0.25 µL BbsI (BpiI) at 5 U/µL (Thermo Fisher), 1 µL vector and 1 µL annealed oligos.
-
bioRxiv - Synthetic Biology 2020Quote: ... 0.25 µL SapI (LguI) at 5 U/µL (Thermo Fisher) and plated on LB agar plates containing 100 µg/mL spectinomycin and 40 µg/mL of X-Gal ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 0.25 µL SapI (LguI) at 5 U/µL (Thermo Fisher), 1 µL of L0 DNA part and 1 µL of pUAP4 ...
-
bioRxiv - Neuroscience 2019Quote: ... 5% CO2 and 37°C in neuronal culture medium (Gibco Neurobasal medium supplemented with 1x Gibco B-27 supplement ...
-
bioRxiv - Biochemistry 2019Quote: ... UBC13 and MMS2 (5 μM) and Alexa Fluor Maleimide (Invitrogen) labeled UbS20C (20 μM ...
-
bioRxiv - Microbiology 2019Quote: ... oCaulo4: 5’/5Biosg/TGGTTCAGGAATATTCACCTG) and MyOne Streptavidin C1 Dynabeads (Invitrogen) as in (Li et al. ...
-
bioRxiv - Microbiology 2019Quote: ... Coverslips were mounted on 5 μL of Prolong Diamond (ThermoFisher) and set for 30 minutes at 37°C or overnight at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... and 5% FCS with Lipofectamine 3000 reagent (Thermo Fisher Scientific) or Transit LT-1 (Mirus ...
-
bioRxiv - Bioengineering 2019Quote: ... and hMSCs and MS-5 in MEM Alpha (Life Technologies). All medium were supplemented with 10 % heat-inactivated fetal bovine serum (FBS) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific) was used to assess the expression levels of the mRNAs ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 5.5 x 10-5 mol/L 2-mercaptoethanol (Gibco). For the endothelial potential assay ...
-
bioRxiv - Genomics 2020Quote: ... Cells were trypsinised for 5 minutes with TrypLE (Life Technologies) before being collected and spun down for 5 min at 300 g ...
-
bioRxiv - Genomics 2020Quote: ... Cells were trypsinised for 5 minutes with TrypLE (Life Technologies) before being collected and spun down for 5 min at 300 g ...
-
bioRxiv - Genetics 2021Quote: ... 5 μl Dynabeads MyOne Streptavidin T1 beads (Thermo Fisher Scientific) were combined and washed according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Samples were analyzed in triplicate on QuantStudio 5 (Thermo Fisher), with at least 2 independent samples for each experiment ...
-
bioRxiv - Genomics 2020Quote: ... 5 µg of RNA was treated with Turbo DNase (Ambion) for 45 min before cDNA synthesis using SuperScript III (Life Technology ...
-
bioRxiv - Genomics 2021Quote: ... Quantitative PCR was performed on the QuantStudio 5 (Thermo Scientific) using the GoTaq qPCR Mastermix (Promega) ...
-
bioRxiv - Immunology 2021Quote: ... for 5 min and mounted with Prolong Gold (Invitrogen, #P36930). Slides were imaged using the Vectra 3.0 spectral imaging system (PerkinElmer) ...
-
bioRxiv - Molecular Biology 2020Quote: ... or a QuantStudio 5 Real-Time PCR System (Applied Biosystems).
-
bioRxiv - Neuroscience 2020Quote: ... 5’-GCCTCCCATCCACAAGAATAGTG-3’ and cloned into pCRII-Blunt-TOPO (Invitrogen). This plasmid was then used to generate digoxigenin-labeled sense and antisense probes.
-
bioRxiv - Neuroscience 2020Quote: ... Fast-Dil (5 mg/ml, dissolved in ethanol, Molecular Probes) was injected into the dorsal part of the spinal cord as described previously (Wilson and Stoeckli ...
-
bioRxiv - Microbiology 2021Quote: ... and the QuantStudio 5 Real-Time PCR System (Applied Biosystems). DNA quantifications were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) ...
-
bioRxiv - Cell Biology 2019Quote: ... or 5 μM Oregon Green 488-X succinimidyl ester (Invitrogen), depending on if fixation of phagocytosis was planned ...
-
bioRxiv - Cancer Biology 2020Quote: ... using an ABI QuantStudio 5 Real-Time PCR System (ThermoFisher). The levels of pmCMV-Gl-Norm and pmCMV-Gl-39Ter cDNA were normalized to phCMV-MUP mRNA abundance for each sample ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were labeled with 5 μM CFSE (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2021Quote: ... After washing with 10% and 5% penicillin–streptomycin solution (Gibco), the tissue was cut into pieces and enzymatically digested using 1 mL 0.5% type I collagenase (Sigma ...
-
bioRxiv - Bioengineering 2021Quote: ... blocked for 45 minutes using 5% goat serum (ThermoFisher #16210064) in PBS with 0.05% sodium azide (Sigma #S2002) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μl of 5 × Vilo reaction mix (Life Technologies, 11754), and 2 μl of 2 × Superscript III enzyme blend (Life Technologies ...
-
bioRxiv - Bioengineering 2021Quote: ... 1 x 5 mg (Thermo Fisher Scientific; cat. no: A44520). Note ...
-
bioRxiv - Neuroscience 2021Quote: ... including 5 μl of fast advanced master mix (Thermofisher Scientific), 1 μl 20X Taqman assay (IDT) ...
-
bioRxiv - Neuroscience 2021Quote: ... Alexa Fluor 647 (Invitrogen; Catalog # A-21450; 5 µg / ml) for 1 hour at room temperature ...
-
bioRxiv - Genetics 2020Quote: ... 100 U Hin1II (NlaIII) (Thermo Fisher ER1831, 5 U/μl), and x μl of water ...
-
bioRxiv - Neuroscience 2021Quote: ... 5% Heat Inactivated Horse Serum (Thermo Fisher Scientific cat. # 26050070), 1% Penicillin/Streptomycin (Thermo Fisher Scientific cat ...
-
bioRxiv - Cell Biology 2021Quote: ... mRNA in 5-10 nl of RNase-free water (Invitrogen) was microinjected into one or two blastomeres of four to sixteen cell stage embryos ...
-
bioRxiv - Cell Biology 2021Quote: ... a Rabbit-anti-Mouse-AlexaFluor488 (ThermoFisher, #A-11059; 5 μg) and an anti-PPARγ (abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... for 5 hours in serum depleted medium (Opti-MEMTM, ThermoFisher), according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... and supplemented with 5% lipoprotein-deficient serum FCS (Life Technologies), and 1% non-essential amino acids (Life Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... at 37°C and 5% CO2 in DMEM (10569; Gibco) supplemented with 15% FBS (FB-11 ...
-
bioRxiv - Plant Biology 2021Quote: ... using 5 μL Power SYBR Green PCR Mix (Applied Biosystems), 2 μL of cDNA ...
-
bioRxiv - Cell Biology 2021Quote: ... brains were incubated with 5 μM DHE (Cat. #D11347, Invitrogen) for 5 minutes at 25°C ...