Labshake search
Citations for Thermo Fisher :
2801 - 2850 of 10000+ citations for Anti Epidermis type lipoxygenase 12 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Proteins were resolved in NuPAGE Novex 4–12% Bis-Tris Protein Gels (Life Technologies) and transferred electrophoretically onto a PVDF 0.45 mm membrane (Millipore) ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein lysates were separated using Bolt™ 4-12% Bis-Tris Plus Gels (Invitrogen) and transferred onto 0.2 μm nitrocellulose membranes (Amersham Bioscience ...
-
bioRxiv - Molecular Biology 2020Quote: ... hybridization was performed at 35°C for 12 h in UltraHyb-Oligo buffer (Ambion) containing desired probes (Pseudo_GlyGCC_10 – TACCACTGAACCACCAATGC ...
-
bioRxiv - Genomics 2020Quote: ... The reaction was stopped by addition of 12 μl 0.5 M EDTA (Invitrogen, #15575038) at 65°C for 20 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... the samples were loaded onto NuPageTM 4-12% Bis-Tris gels (ThermoFisher Scientific, NP0321BOX) and run in 1x MOPS buffer at 140V for 45 minutes ...
-
bioRxiv - Systems Biology 2021Quote: ... the samples were loaded on NuPAGE™ Novex™ 4-12% Bis-Tris (Invitrogen), and blotted onto 0,22 µm Amersham™ Protran® nitrocellulose membranes (Merck) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Protein lysates were separated on 4-12% Bis-Tris gels (Invitrogen, Thermo Fisher Scientific). Phosphorylated p44/42 (p-p44/42 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Protein lysates were separated on 4-12% Bis-Tris gels (Invitrogen, Thermo Fisher Scientific). Phosphorylated p44/42 (p-p44/42 ...
-
bioRxiv - Biochemistry 2020Quote: ... A 10 to 12 molar excess of Oregon Green 488 Maleimide (Invitrogen O-6034) was added to the actin dropwise with stirring ...
-
bioRxiv - Pathology 2020Quote: ... The resulting pellet was resuspended in 12% Percoll solution (Fisher Scientific, 45-001-74) prepared in mitochondrial isolation buffer followed by centrifugation at 6,900 g for 10 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... samples were separated on an Invitrogen Bolt 4-12% Bis-Tris gel (Invitrogen, USA) with MES SDS Running buffer (ThermoFisher Scientific ...
-
Bat influenza vectored NS1-truncated live vaccine protects pigs against heterologous virus challengebioRxiv - Microbiology 2020Quote: ... and extracted cell lysates were loaded to 4-12% Bis-Tris polyacrylamide gel (Invitrogen). The loaded gel was transferred onto a polyvinylidene difluoride (PVDF ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Select polymerase variants were characterized by 4-12% Bis-Tris protein gels (Thermo Fisher) to confirm the presence of polymerase and pore conjugates (Supplementary Fig ...
-
bioRxiv - Molecular Biology 2020Quote: ... and equal volumes were run on 4-12% NuPAGE protein gels (Thermo Fisher Scientific). Gels were exposed to phosphor screens and imaged on a Typhoon FLA 9500 phosphoimager ...
-
bioRxiv - Physiology 2020Quote: ... were subjected to electrophoresis on 4–12% Bis-Tris polyacrylamide gels (Novex, Life Technologies) and transferred to PVDF membranes (Millipore) ...
-
bioRxiv - Genetics 2020Quote: ... then 10 μg were loaded and separated on 4–12% NuPage acrylamide gels (ThermoFisher, NuPAGE 10% Bis-Tris Midi Protein Gels ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 12 mM sodium deoxycholate) supplemented immediately prior to lysis with protease (Thermo Fisher, 78430) and phosphatase (Sigma-Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... separated by electrophoresis in NuPAGE 4-12% polyacrylamide gels (Thermo Fisher Scientific, Cat#NP0321PK2) and then transferred to PVDF membranes ...
-
bioRxiv - Immunology 2020Quote: ... were then separated on a 4-12% Bis-Tris gel (NuPAGE™, ThermoFisher Scientific) in a 4-Morpholinepropanesulfonic acid (MOPS ...
-
bioRxiv - Physiology 2020Quote: ... Cell lysates were separated on Bolt 4-12% Bis-Tris plus (Thermo Fisher Scientific) and transferred to PVDF membranes with iBlot 2 (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... kindly provided by Georg Herrler) and cultivated in DMEM/F-12 Medium (ThermoFisher Scientific) supplemented with 10% FCS ...
-
bioRxiv - Molecular Biology 2020Quote: Samples were separated using 4-12% Bis-Tris NuPAGE gels (Thermo Fisher Scientific, NP0336BOX) at 200 V using 1 X NuPAGE Running Buffer [50 mL of 20 × 1 L Stock [209.2 g MOPS (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... Lysates were then subjected to SDS-PAGE using pre-cast 4-12% gels (Invitrogen) and transferred to nitrocellulose membranes ...
-
bioRxiv - Plant Biology 2021Quote: ... and separated by polyacrylamide gel electrophoresis (Nu-PAGE 4-12% Bis-Tris gel, Invitrogen, Life Technologies Corporation ...
-
bioRxiv - Microbiology 2021Quote: ... Each sample was loaded into 4-12% Bis-Tris 10-well protein gels (Invitrogen) for immunoblotting.
-
bioRxiv - Biochemistry 2021Quote: ... Samples were then loaded on BOLT 4-12% Bis-Tris gels (Thermo Fisher Scientific) and proteins were separated by SDS-PAGE ...
-
bioRxiv - Biochemistry 2021Quote: Human embryonic kidney (HEK293F) cells were cultured in DMEM/F-12 GlutaMAX medium (Invitrogen) supplemented with 10% fetal bovine serum (Sigma–Aldrich ...
-
bioRxiv - Biochemistry 2021Quote: ... SDS-PAGE was performed using Bolt™ 4–12 % Bis-Tris gels (Thermo Fisher) in Bolt™ MOPS SDS running buffer ...
-
bioRxiv - Biochemistry 2021Quote: SDS-PAGE was performed using NuPAGE 4-12% Bis-Tris gels (Thermo Fisher Scientific). For Western blots ...
-
bioRxiv - Biochemistry 2021Quote: ... Electrophoresis was carried out using NUPAGE Bis-Tris 4-12% gradient gels (Life Technologies) and run at 120 V ...
-
bioRxiv - Developmental Biology 2021Quote: ... undifferentiated hiPSCs were passaged into 12-well plates using Versene (Thermo Fisher Scientific, #15040066). When hiPSC culture reached 90-95% confluency ...
-
bioRxiv - Cell Biology 2021Quote: ... NuPAGE Novex 4%–12% Bis-Tris gradient gel with MES running buffer (Thermo Fisher) was used ...
-
bioRxiv - Genomics 2020Quote: ... Samples were resolved by SDS-PAGE using a NuPAGE 4–12% gel (Life Technologies). Proteins were transferred onto a nitrocellulose filter (BioRad ...
-
bioRxiv - Biophysics 2020Quote: ... Excess liquid was removed by blotting for 12 s with a Vitrobot (Thermo Fisher) under 100% humidity at 20°C ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were resolved by SDS-PAGE (Bolt 4– 12% Bis-Tris plus gel, Invitrogen) and transferred to a nitrocellulose membrane using an iBlot 2 gel transfer device (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: hTERT-RPE-1 cells (ATCC) were cultured in DMEM F-12 + Glutamax medium (GIBCO) supplemented with 10% fetal bovine serum (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2020Quote: ... Equal amounts of samples were resolved on 4 to 12% Bis-Tris gels (Invitrogen). Coomassie blue–stained gels were used as loading controls ...
-
bioRxiv - Cell Biology 2021Quote: ... separated on a NuPAGE 4-12% Bis-Tris protein gel (Thermo Fisher Scientific, #NP0336BOX), and transferred onto a nitrocellulose membrane ...
-
bioRxiv - Genetics 2021Quote: ... coated with D-MEM/F-12 supplemented with 20% of KnockOut Serum replacement (Gibco) and 10 μg/mL of Basic Fibroblast Growth Factor (bFGF ...
-
bioRxiv - Microbiology 2021Quote: RAW 264.7 cells were seeded onto 12-mm glass-based dish (Thermo Scientific, USA), allowed to propagate overnight ...
-
bioRxiv - Immunology 2020Quote: ... Protein lysates were added to a Bolt 4-12% Bis-Tris-Plus Gel (Invitrogen). After 30 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... the proteins were resolved on 4 to 12% NuPAGE Bis-Tris gels (Thermo Fisher) and transferred to a nitrocellulose membrane with an iBlot2 system (Thermo Fisher) ...
-
bioRxiv - Immunology 2020Quote: ... separated by SDS-PAGE using 4-12% Bis-Tris gels (NuPAGE, Thermo Fisher Scientific) and transferred onto nitrocellulose membranes using the iBlot system (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4 µg protein was resolved on NuPAGE 4-12% Bis-Tris protein gels (ThermoFisher) and transferred to PVDF membrane (Fisher) ...
-
bioRxiv - Immunology 2020Quote: ... and the eluted proteins resolved on a 4-12% Bis-Tris SDS-PAGE (Invitrogen) with MagicMark (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... Eluted proteins were resolved on a 4-12% Bis-Tris SDS-PAGE gel (Invitrogen) with SeeBlue 2 (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... and analysed by SDS-PAGE using Novex 4-12% Bis-Tris NuPAGE gels (Invitrogen). For the analysis of mitochondria-enriched fractions ...
-
bioRxiv - Genomics 2021Quote: ... The cells on coverslips were mounted on slides (Fisher Scientific, Cat# 12-544-2) with 10 µL ProLong antifade glass mountant with NucBlue stain (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... in Dulbecco’s modified Eagle’s medium: Ham’s F-12 (DMEM/F12, ThermoFisher Scienticfic, Waltham, US.) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2021Quote: ... coli (K-12 strain), and Staphylococcus aureus (Wood strain, without protein A) (Molecular Probes), were washed 3 times with PBS by centrifugation and sonicated for 3 times at 50 KHz for 20 s ...