Labshake search
Citations for Thermo Fisher :
2751 - 2800 of 7736 citations for Recombinant Human TNFRSF4 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... The resulting PCR product was cloned between 5’ KpnI and 3’ EcoRI sites of the pMT/V5-His vector (Invitrogen). In-frame Tag-RFP-T gene was then introduced at the 3’ end of γ-tubulin gene between 5’ EcoRI and 3’ NotI sites ...
-
bioRxiv - Cell Biology 2019Quote: ... The resulting PCR product was then inserted into the 5’ SpeI and 3’ EcoRI sites of the pMT/V5 His-B vector (Invitrogen) containing in-frame mTurquoise2 gene at the 5’ end ...
-
bioRxiv - Biochemistry 2019Quote: ... the polynucleotides encoding GtACR1 mutants were fused in frame with a C-terminal eight-His tag and subcloned into the pPIC9K vector (Invitrogen) between EcoRI and NotI sites ...
-
bioRxiv - Bioengineering 2019Quote: ... precipitate and soluble of was checked for the expression by SDS-PAGE and confirmed indirectly by Western blot with anti-his antibody (Invitrogen).
-
bioRxiv - Synthetic Biology 2019Quote: ... An anti-6His antibody (6x-His Tag Polyclonal Antibody) and an anti-HA antibody (HA Tag Polyclonal Antibody) were purchased from Invitrogen. Western blot analysis was conducted as described previously 45.
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... The BglII and EcoRI restriction sites were used to insert the sequence into the pMT/BIP/V5-His plasmid (ThermoFisher). The production of recombinant IrSPI protein was performed by the Recombinant Proteins in Eukaryotic Cells Platform ...
-
bioRxiv - Molecular Biology 2019Quote: ... Emulsion PCR was performed using the Ion PGM Hi-Q View OT2 Kit and the Ion OneTouch 2 system (ThermoFisher). Template-positive ion sphere particles (ISPs ...
-
bioRxiv - Molecular Biology 2019Quote: ... Enriched ISPs were loaded on a PGM 314R v2 chip and sequenced using the Ion PGM Hi-Q View Sequencing Reagents (ThermoFisher). Raw sequencing data were processed using the Torrent Suite software v5.0 (ThermoFisher) ...
-
bioRxiv - Genomics 2021Quote: ... TaTLP2-B gene was re-amplified from the confirmed clone using the same primers and ligated into the pYES2.1/V5-His-Topo vector (Invitrogen, USA). The recombinant plasmid (pYES2.1-TaTLP2-B ...
-
bioRxiv - Immunology 2021Quote: ... each mouse Siglec gene containing 2-3 domains with pairs of forward and reverse primers (Table S5) were cloned into pcDNA5/FRT/V5-His-TOPO vector (Invitrogen), which contained a C-terminal hIgG1-Fc ...
-
bioRxiv - Microbiology 2021Quote: ... with a N-terminal gp67 signal peptide for secretion and a C-terminal 6×His tag for purification was inserted into pFastBac-Dual vector (Invitrogen). The recombinant baculoviruses were generated according to the manufacture’s instruction to infect Hi5 cells at a density of 2×106 cells/ml ...
-
bioRxiv - Biophysics 2021Quote: The bacteriophage T7 gp15 gene was inserted into the pRSET-B vector (ampr and 6x-His tag) from Invitrogen (USA), between the XhoI and EcoRI restriction sites ...
-
bioRxiv - Biochemistry 2020Quote: ... the opsin-encoding constructs were fused in frame with a C-terminal eight-His tag and subcloned into the pPIC9K vector (Invitrogen). Mutants were generated with Quikchange XL kit (Agilent Technologies ...
-
bioRxiv - Biochemistry 2020Quote: ... with a N-terminal 8x His tag was expressed from the pSJ2 vector (84) in BL21 E.coli and purified by Ni-NTA resin (Thermo Fisher). Full-length human Src kinase (WT or K298M ...
-
bioRxiv - Neuroscience 2020Quote: ... for 48 h then transfected for 24 h with 1 ug His-G3BP1 3’UTR constructs using Lipofectamine LTX and Plus reagent (Invitrogen). To determine mRNA stability ...
-
bioRxiv - Cancer Biology 2021Quote: ... Biotinylated RNA baits were used in a ratio 1:12 to Hi-C libraries (25 ng biotinylated RNA baits per 300 ng of Hi-C library) and supplemented with 30 units SUPERase-In (Ambion). Biotinylated RNA baits for capture DNA-Seq were used in a ratio of 1:3.33 (300 ng RNA baits per 1,000 ng genomic DNA library ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 ml of Dynal sheep-anti mouse IgG paramagnetic beads were non-covalently coupled with 60 µg of anti-His mAb (Invitrogen) in PBS plus 0.1% immunoglobulin-free BSA (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... M-OPG2 and S-OPG2 were generated by inserting the respective cDNAs in frame between NheI and AflII sites of a pcDNA5/FRT/V5-His vector (Invitrogen) containing a C-terminal OPG2 tag (MNGTEGPNFYVPFSNKTG) ...
-
bioRxiv - Cell Biology 2021Quote: qPCR analysis was performed using the LabTaq Green Hi Rox (Labtech) following manufacturer’s instructions on a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems) and primers listed in Supplementary Table S4.
-
bioRxiv - Plant Biology 2021Quote: ... fused with a six-HIS tag at the C-terminus were expressed using the Bac-to-Bac baculovirus expression system (Invitrogen) in High Five cells at 22 °C as reported previously 23 ...
-
bioRxiv - Microbiology 2021Quote: ... Amplified fragments were digested with KpnI and XhoI and cloned into the pre-cut pcDNA4/myc-His A vector (Invitrogen) by using the DNA ligation Kit (Takara) ...
-
bioRxiv - Microbiology 2019Quote: ... the sequence coding for vpa0226 was amplified using primers 5’ GATCCTGCAGATGCTTAAAATTAAACTGCCT 3’ and 5’ GATA GAATTCTTACTTATCGTCGTCATCCTTGTAATC 3’ and then cloned into the pBAD/Myc-His vector (Invitrogen, resistance changed from ampicillin to kanamycin ...
-
bioRxiv - Molecular Biology 2022Quote: ... with FLAG sequence flanking at 5’ end of the primer and cloned in Hind III and Xba I site of pCDNA3.1V5-His (Invitrogen, USA). Clones were sequenced with T7 and BGH primer using ABI BigDyeTerminator V3.1 cycle sequencing kit followed by automated sequencing in ABI 3130 Genetic Analyzer according to manufacturer’s protocol.
-
bioRxiv - Microbiology 2019Quote: ... 1 nM of CAT protein (Chloramphenicol acetyltransferase, containing a 6×His tag at C-terminus) expressed in the same baculovirus-expression system (ThermoFisher) was used to coat plate wells ...
-
bioRxiv - Microbiology 2020Quote: ... 2015) were produced from C6/36 cell line cultured in L-15 (HyClone) supplemented with 1.5% HI-FBS (ThermoFisher Scientific), 10% tryptose phosphate ...
-
bioRxiv - Cell Biology 2022Quote: The cDNA coding for fibulin1C (Uniprot number P23142-4) with a C-terminal 6x His tag was custom-synthesized by Invitrogen and transiently transfected in HEK293 T cells using polyethylenimine in OPTIMEM (Invitrogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... F 5’-GAACTGTCCAGATGCCCTTCCAGTT-3’ and R 5’-GCATCTGGACAGTTCTGGGAAGCCCG-3’) was cloned by PCR and ligated into the pEF6/V5-His TOPO plasmid vector (Invitrogen). FBLN7-V5-His vector was transfected into CHO cells (FBLN7-CHO ...
-
bioRxiv - Cell Biology 2022Quote: ... cell lines were maintained in Ham’s F12 media (Hi Media, India) supplemented with (10%) fetal bovine serum (FBS, Gibco, USA). Plasmids were either expressed stably (FR-GPI ...
-
bioRxiv - Microbiology 2020Quote: ... using the primers in Table II and after digestion with BamHI and XhoI was cloned into pCDNA™3.1/myc-His A (Invitrogen). CHIKV structural genes were initially PCR amplified from pDONR21-CHKVstr (60 ...
-
bioRxiv - Molecular Biology 2020Quote: ... following which protein-protein complexes were purified with Pierce(tm) His Protein Interaction Pull-Down Kit (Thermo Fisher Scientific, #21277) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human Drosha cDNA with a Flag-tag at the amino-terminus and a 6 x his tag at the carboxyl-terminus was cloned into pcDNA4/TO (Invitrogen) to construct the inducible WT Drosha expressing plasmid for immunoprecipitation assay and ubiquitination assay ...
-
bioRxiv - Genomics 2020Quote: ... We then amplified the library using Hi-fidelity KAPA PCR kit (KAPA) for 6 cycles and quantified the library using Qubit high sensitivity DNA assay (Thermofisher). We performed QC using bioanalyzer (Agilent ...
-
bioRxiv - Genomics 2020Quote: ... We then amplified the library using Hi-fidelity KAPA PCR kit (KAPA) for 6 cycles and quantified the library using Qubit high sensitivity DNA assay (Thermofisher). We performed QC using bioanalyzer (Agilent ...
-
bioRxiv - Microbiology 2021Quote: The SARS-CoV-2 NTD (residues 13-303) or RBD (residues 319-541) with a C-terminal His tag was cloned into a modified pFastBac vector (Invitrogen) that encodes a melittin signal peptide before the NTD or RBD ...
-
bioRxiv - Immunology 2020Quote: ... containing the gp67 secretion signal peptide and a C-terminal 6×His tag was inserted into pFastBac-Dual vectors (Invitrogen) and transformed into DH10Bac component cells ...
-
bioRxiv - Microbiology 2021Quote: ... VF-Hi and VF-Lo (generated from this study) were maintained in Dulbecco′s Modified Eagle′s Medium (DMEM) (Gibco) supplemented with 10% FBS ...
-
bioRxiv - Microbiology 2022Quote: ... which were subsequently purified and ligated upstream the His-tag into the expression vector pTrcHis2 (Invitrogen™, cat. n° V36520). The recombinant vectors were transformed into the ΔarsC E ...
-
bioRxiv - Genetics 2022Quote: ... The blasticidin resistance gene coding sequence was amplified by PCR with the primers BlasS SacII F1 and BlasS BamHI R3 from pcDNA6/V5-His-A (Invitrogen):
-
bioRxiv - Microbiology 2022Quote: ... qRT-PCR was performed using the qPCRBio SyGreen Mix Hi-ROX (PCR biosystems) according to the manufacturer’s instructions and run on the Real Time PCR QuantStudio3 (ThermoFisher scientific) using the following conditions – Initial denaturation step at 95□ °C for 2 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... The supernatant obtained after the centrifugation of the lysate at 9000 rpm for 25 minutes at 4°C was subjected to overnight binding with Hi-bind Ni-NTA agarose beads (Invitrogen). The beads were washed 4-5 times with wash buffer (20mM Tris ...
-
bioRxiv - Cancer Biology 2019Quote: ... The PCa cells were maintained in F-12K media with 10% HI fetal bovine serum (FBS) (Gibco, Grand Island, NY). Once reaching 80-90% cellular confluence ...
-
bioRxiv - Microbiology 2020Quote: ... fused to a Gly-Ser-Gly linker and a Myc epitope tag into the EcoRV site of pEF1 V5 His C (Invitrogen) using NEB HiFi Assembly Mix (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2020Quote: ... flow cytometry and in vivo binding assays) were subcloned via NcoI/EcoRI or HindIII/BamHI into either the pBAD/His A (Invitrogen) or pZA23MCS (EXPRESSYS ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and SC-His-Ura (for Ty1his3-AI) or YEPD + Geneticin (G418; 200 μg/ml for Ty1neo-AI) (ThermoFisher, Waltham MA) plates ...
-
bioRxiv - Biochemistry 2020Quote: The C-terminal fragments of Stu2 used in the pulldown experiments were cloned into a pLIC vectors with a TEV-cleavable N-terminal 6-His tag and transformed into Bl-21 AI cells (Invitrogen). Cells were grown to an OD600 of 0.6 in TB media with 0.1% glucose and were induced by addition of IPTG and arabinose to 200 μM and 0.2% ...
-
bioRxiv - Physiology 2021Quote: ... The resulting cell pellet was resuspended in hypotonic buffer and used for Western blotting using HRP-conjugated anti-His antibody (1: 10,000; Novex, Life technologies).
-
bioRxiv - Biochemistry 2020Quote: ... the opsin-encoding constructs were fused in frame with a C-terminal 8-His tag and subcloned into the pPIC9K (A1ACR1, HfACR1 and AlACR2) or pPICZα (AlACR3) vector (Invitrogen) according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2019Quote: ... blocked with 5% milk in TBST and probed with 6x-His Tag Monoclonal Antibody (HIS.H8) (ThermoFisher MA1-21315, 1:3000). Blots were incubated with primary antibodies overnight at 4 °C with rocking and were then washed (3×5min ...
-
bioRxiv - Cell Biology 2019Quote: ... and sequencing was performed on an Ion Proton system using with Ion PI Hi-Q sequencing kit (Thermo Fisher Scientific) the PI v3 chip (Thermo Fisher Scientific) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The presence of AhR and ARNT proteins was verified by Western blot using anti-His-tag (mouse monoclonal, MA1-21315, dilution 1:1000, Invitrogen) anti-FLAG-tag (rabbit monoclonal ...