Labshake search
Citations for Thermo Fisher :
2701 - 2750 of 10000+ citations for Urea Nitrogen BUN Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: RNA was extracted from 8-μm snap frozen sections of distal femur and proximal tibial growth plates in Axin2CreERT2;R26RTdTomato mice using the Picopure RNA Isolation Kit (KIT0204, Thermo Fisher) as previously described.56 Microdissections of resting chondrocytes and proliferative chondrocytes were performed using a Leica LMD 7000 laser microdissection system (Leica Microsystems) ...
-
ALS iPSC-derived microglia and motor neurons respond to astrocyte-targeted IL-10 and CCL2 modulationbioRxiv - Neuroscience 2023Quote: Calcium flux was measured in MNs seeded in a 96 well plate using the Fluo-4 NW Calcium Assay Kit (ThermoFisher, #F36206) per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Cells were seeded in 96 well plates (6055302, Revvity) and stained with Blue/Green ReadyProbes Cell Viability Imaging Kit (Invitrogen, R37609) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... 20 clones from each plate were expanded and genomic DNA extracted by a GeneJet Genomic DNA Purification Kit (ThermoFisher Scientific, K0722) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... extracted from a single well of a 6-well plate using a mixture of RIPA lysis buffer and protease inhibitor then quantified using Pierce BCA kit (ThermoFisher Scientific), were separated via SDS-PAGE and subsequently transferred onto PVDF membranes ...
-
bioRxiv - Molecular Biology 2023Quote: ... cell culture plates (12-well plates were Corning™ Costar™ cat# 3513 and 6-well plates were Thermo Fisher Scientific Nunc™ cat# 140675) were coated with GeltrexTM (Gibco ...
-
bioRxiv - Molecular Biology 2023Quote: ... cell culture plates (12-well plates were Corning™ Costar™ cat# 3513 and 6-well plates were Thermo Fisher Scientific Nunc™ cat# 140675) were coated with GeltrexTM (Gibco ...
-
bioRxiv - Developmental Biology 2020Quote: 30,000 thawed hESCs were cultured in single wells of a 48-wells plate and decidualized by adding DMEM/F12 phenol red-free medium supplemented with 10% heat-inactivated charcoal stripped FCS (Thermo Fisher Scientific, Waltham, MA, USA), 0.5 mM 8-bromoadenosine 3□,5□-cyclic monophosphate (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... the transwell was moved to a standard 6-well cell culture plate and submerged in 10% neutral-buffered formalin (Fisher Scientific Cat. #22-026-435) for at least 24h ...
-
bioRxiv - Biophysics 2022Quote: ... Growth rates were measured by monitoring optical density at 600 nm (OD600) every 10 min in a multiwell plate reader (Varioskan Flash2, Thermo Fisher Scientific, Waltham, MA, USA) and fitting the data to a logistic function ...
-
bioRxiv - Bioengineering 2022Quote: ... 100 μL of AIM-V medium and 10 μL of the prepared cell suspension was added to each well (Thermo Scientific Nunc™ F96 MicroWell™ Polystyrene Plate, Thermo Fisher Scientific). The seeded chips and well plates were incubated at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: 8 TMT reagents from a 10-plex reagent kit were used to label desalted peptides (Thermo Fisher) as directed by the manufacturer ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: DNA was extracted from approximately 10 mg tissue using the PureLink Genomic DNA Mini Kit (Life Technologies). DNA quality control was performed using the Agilent 2200 TapeStation and the Genomic DNA ScreenTape kit to determine the DNA integrity number (DIN).
-
bioRxiv - Microbiology 2020Quote: ... for 10 minutes followed by total RNA isolation using the ToTALLY RNA total RNA Isolation kit (Ambion) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2020Quote: ... Up to 10 μg extracted RNA was DNase treated using the TURBO DNA-free kit (Applied Biosystems) as per manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... TNFα and IL-10 levels were measured by TNFα Mouse Uncoated ELISA Kit (88-7324-86, Invitrogen) and IL-10 Mouse Uncoated ELISA Kit (88-7105-86 ...
-
bioRxiv - Molecular Biology 2020Quote: ... A total of 10 µg of RNA was reverse-transcribed using Superscript IV Reverse-Transcription kit (Invitrogen) using an hTERT specific probe in exon-4 (CCTGACCTCTGCTTCCGACAG) ...
-
bioRxiv - Genomics 2019Quote: ... We extracted cfDNA from 10 ml urine using MagMAX Cell-Free DNA Isolation kit (Thermo Fisher Scientific) and eluted in 20-30 μl ...
-
bioRxiv - Microbiology 2019Quote: ... cDNA was synthesized from 10 ng of RNA using the Superscript III first strand synthesis kit (Invitrogen). The expression of rodA1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Poly(A)+ RNA was isolated from 10 ug total RNA using a Dynabeads mRNA isolation kit (Invitrogen), repeated twice to remove all residual rRNA contamination ...
-
bioRxiv - Microbiology 2022Quote: ... 10 μg of purified RNA was analyzed for rRNA processing by Northern blot using NorthernMax kit (Invitrogen) and probes listed in Table S3.
-
bioRxiv - Microbiology 2023Quote: ... with 10 µl of each sample and 200 µl of Coomassie (Bradford) Protein Assay Kit (Thermo Scientific) and incubated for 10 min at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... Tandem mass tag labeling (TMT) was performed using the TMT 10-plex reagent kit (ThermoFisher, Waltham, MA). Detailed methods of liquid chromatography-mass spectroscopy analysis is included in the Supplemental Material.
-
bioRxiv - Cancer Biology 2022Quote: ... 10 ng of total RNA were reverse transcribed using a TaqMan MicroRNA Reverse Transcription Kit (ThermoFisher Scientific) and RT specific primers for miRNAs (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... and DNA extraction from approximately 5 × 10? purified particles (using the Purelink Genomic extraction mini kit, ThermoFisher) have been previously described [49] ...
-
bioRxiv - Molecular Biology 2023Quote: ... or electroporated into Hepa1-6 cells using a Neon Transfection System 10 µl kit (ThermoFisher MPK 1096) with the following electroporation parameters ...
-
bioRxiv - Neuroscience 2023Quote: ... 10 individual samples and one composite sample were labeled using the TMT 11-plex kit (ThermoFisher 90406). Labeling was performed as previously described (Higginbotham et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... which were transfected into HPSI0913i-diku_1 cells using the Neon transfection 10 µl kit (Thermo Fisher Scientific), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... reverse transcription of RNA (10-200ng) was performed using the TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems) with the target-specific Taqman™ RT primers (Thermo Fisher ...
-
bioRxiv - Microbiology 2020Quote: ... The amplified DNA from one 96-well plate was normalized using a SequalPrep Normalization Plate (Invitrogen), and pooled into a single library ...
-
bioRxiv - Bioengineering 2020Quote: ... or rectangular uniwell plates with overall dimensions of 96-well plates (Thermo Fisher Scientific, Waltham, MA) using custom-written software (see also below ...
-
bioRxiv - Microbiology 2022Quote: ... Supplementary Table 3) and added (100 μL/well) to ELISA plates (Maxisorp Nunc-immuno plates; Thermo). Since Iwate/2019(H3N2 ...
-
bioRxiv - Immunology 2022Quote: HLA-G+ EVTs were seeded on fibronectin-coated tissue culture plates (Nunc Cell-Culture Plates, ThermoFisher) at a density of 1 million cells/ml EVT culture medium ...
-
bioRxiv - Molecular Biology 2020Quote: ... The assay was performed on 96-well plates (MicroAmp Fast 96-Well Reaction Plate, Applied Biosystems), in a total volume of 25 μL for each reaction ...
-
bioRxiv - Immunology 2022Quote: HLA-G+ EVTs were seeded on fibronectin-coated tissue culture plates (Nunc Cell-Culture Plates, ThermoFisher) at a density of 1 million cells/ml EVT culture medium ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reactions were prepared as follows in 384 well plates (MicroAmp Optical 184-Well Reaction Plate, Thermofisher): 5 µL Luna one-step reaction mix ...
-
bioRxiv - Microbiology 2023Quote: ... with a collection plate (deep well storage plate, 96-well, 2,2 mL; Thermo Fisher Scientific, Germany).
-
bioRxiv - Genomics 2023Quote: ... 10% FBS(Gibco™ #10-082-147), 1% Non-essential Amino Acid (100X ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 96-well plate (Thermo Fisher Scientific). In brief ...
-
bioRxiv - Immunology 2021Quote: ... High-binding 96-well plates (Nunc) were coated with the appropriate antigen (S1 protein 1.2 μg/ml ...
-
bioRxiv - Molecular Biology 2021Quote: ... 96-well ELISA plates (Nunc, Germany) were coated with SARS-CoV-2 specific antigen (S1-RBD at a concentration of 1.5μg/well in PBS pH 7.4) ...
-
bioRxiv - Neuroscience 2021Quote: ... Custom TaqMan array plates (Thermofisher, 4413261) were used for the Wnt ligand screen ...
-
bioRxiv - Cell Biology 2022Quote: ... black optical 96 well plates (Nunc) and allowed to attach overnight ...
-
bioRxiv - Immunology 2022Quote: MaxiSorp ELISA plates (Thermo Fisher Scientific) were coated with 2 μg/ml purified RBD or S protein in 1xBBS (140 mM NaCl ...
-
FOXO dictate initiation of B cell development and myeloid restriction in common lymphoid progenitorsbioRxiv - Immunology 2022Quote: ... MaxiSorp ELISA plates (Thermo Fisher Scientific) were coated with 10-20µg/ml of anti-mouse immunoglobulin (Ig ...
-
bioRxiv - Microbiology 2022Quote: ... High-binding ELISA plates (Thermo Scientific) were coated with capture antibody and incubated overnight at room temperature ...
-
bioRxiv - Immunology 2019Quote: ... flat MaxiSorp 96-well plates (Nunc) were coated overnight with the vaccine (diluted 1:3000 in DPBS ...
-
bioRxiv - Biochemistry 2019Quote: On a Maxisorp plate (Nunc, Denmark) 100 μl purified Spy-2 was coated O/N at 4 °C in a concentration ranging from 0.032 – 3.2 μM in coating buffer (100 mM NaHCO3-buffer ...
-
bioRxiv - Immunology 2020Quote: ... Polysorp 96-wells microtiter plates (Nunc) were coated with Salmonella typhosa LPS (40 μg/mL ...
-
bioRxiv - Immunology 2019Quote: ... 96 well ELISA plates (Thermo Fisher) were coated with either goat anti-human Ig (10μg/ml ...