Labshake search
Citations for Thermo Fisher :
2701 - 2750 of 10000+ citations for Human Cathepsin B ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... with B-27 Plus Supplement (Thermo Fisher Gibco; Cat Number: A3582801) and CTS GlutaMAX I Supplement (Thermo Fisher Gibco ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with B-27 (1% v/v, 17504044; Thermo Fisher Scientific), retinoic acid (2 μmol/L ...
-
bioRxiv - Genomics 2024Quote: ... 0.5X B-27 Supplement (GIBCO/Thermo Fisher Scientific; Cat. No. 17504044), 10 ng/mL NT-3 ...
-
bioRxiv - Cancer Biology 2024Quote: ... GSK3A/B DKO HEK293T cells were transfected using Lipofectamine 3000 (Invitrogen) according to manufacturer’s instructions.
-
bioRxiv - Microbiology 2024Quote: ... b) H2 /CO2 atmosphere (80-20%) + trimethylamine (15 mM; ACROS organics); and c ...
-
bioRxiv - Genomics 2024Quote: ... and 10μL/50 mL Amphotericin B (ThermoFisher Scientific, cat. no. 15290018). HAECs at low passage (passage 3-6 ...
-
bioRxiv - Neuroscience 2024Quote: ... supplemented with B-27™ Plus Supplement (ThermoFisher, Gibco; Catalog#: A3582801) and GlutaMAX™ Supplement (ThermoFisher ...
-
bioRxiv - Neuroscience 2024Quote: ... supplemented with B-27™ Plus Supplement (ThermoFisher, Gibco; Catalog#: A3582801) and GlutaMAX™ Supplement (ThermoFisher ...
-
bioRxiv - Plant Biology 2022Quote: RT-qPCR analysis was performed using an Absolute Blue qPCR SYBR Green ROX Mix (AB-4162/B) kit (Thermo Fisher Scientific, Waltham, MA 15 USA). Reactions were performed using a Rotor-Gene 6000 cycler (Corbett Research ...
-
bioRxiv - Molecular Biology 2021Quote: RT-qPCR analysis was performed using an Absolute Blue qPCR SYBR Green ROX Mix (AB-4162/B) kit (Thermo Fisher Scientific, Waltham, MA 15 USA). Reactions were performed using a Rotor-Gene 6000 cycler (Corbett Research ...
-
bioRxiv - Bioengineering 2021Quote: ... + 2% human serum albumin (ThermoFisher) + 5 μM ROCKi (Tocris) ...
-
bioRxiv - Cell Biology 2020Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knock down GR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... including human 293FT cells (Invitrogen), rat2 cells (ATCC #CRL-1764) ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Genetics 2019Quote: ... human COT-1 DNA (Invitrogen) and biotin-labeled mouse COT-1 or minor satellite DNA (a gift from Dr ...
-
bioRxiv - Genetics 2021Quote: ... human COT-1 DNA (ThermoFisher) to detect HSA21 and biotin-labeled I-EGFP-I-loxP-3’HPRT (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... recombinant human Vitronectin (Gibco A14700) was used at a final concentration of 25ug/ml ...
-
bioRxiv - Cancer Biology 2020Quote: Human recombinant IL-1β (ThermoFisher) was reconstituted in deionised water and administered at 10 ng/ml.
-
bioRxiv - Cell Biology 2021Quote: ... human FMR1 (Ambion, USA, 4392420) and human ATF4 (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... AlexaFluor633 anti-human (all ThermoFisher) used 1:2000 in PBS with 0.2% BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human CD11b-APC (Thermo Fisher); Human CD34-PE (Miltenyi Biotec);and Human CD33-APC-Cy7 (Abcam).
-
bioRxiv - Microbiology 2020Quote: ... and anti-human SPIB (Invitrogen) antibodies by incubating for 45 minutes at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: Human epidermal keratinocytes (HEKs, Thermofisher), and patient keratinocytes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human Epidermal Melanocyte cells (Invitrogen) were cultured in Medium 254 (Invirogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... and recombinant human FGF2 (Invitrogen) at 20 ng/ml ...
-
bioRxiv - Immunology 2021Quote: Human iPS cells (Thermo Fisher) were cultured on vitronectin-coated T225cm2 flasks using complete mTesSR Plus medium (StemCell Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... human COT1 DNA (Invitrogen, 15279011) and Vysis CEP hybridization buffer (Abbott Molecular ...
-
bioRxiv - Immunology 2020Quote: ... Human Expi293 cells (Thermo Scientific) were transfected with these constructs using FectoPro (PolyPlus Transfection ...
-
bioRxiv - Neuroscience 2021Quote: Human iPSCs (Thermo Fisher #A18945) were maintained in mTeSR1 medium (StemCell ...
-
bioRxiv - Neuroscience 2022Quote: ... and human ACTB (Thermofisher Hs01060665_g1). For other qPCRs ...
-
bioRxiv - Microbiology 2023Quote: ... human Gas6 (Invitrogen, cat# BMS2291), mouse Axl (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... Human primary astrocytes (ThermoFisher #N7805200) were maintained as described in user manual ...
-
bioRxiv - Molecular Biology 2024Quote: ... human COT1 DNA (#15279011, Invitrogen) and 3 volumes of ethanol (#10000652 ...
-
bioRxiv - Immunology 2024Quote: ... or anti-human (Invitrogen #A11013) secondary antibodies at 20 μg/mL in PBS/2% BSA for 30 min ...
-
bioRxiv - Systems Biology 2023Quote: ... and human IgE-PE (ThermoFisher). Antibody details are shown in Table S4 ...
-
bioRxiv - Genomics 2023Quote: ... human p53 (Invitrogen, PA5-27822), MDM2 (Santa Cruz Biotechnology ...
-
bioRxiv - Physiology 2023Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knockdown GR ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD235a (#17998742, Invitrogen), anti-human CD326 (EpCAM ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD45 (#17945942, Invitrogen), anti-human CD235a (#17998742 ...
-
bioRxiv - Cell Biology 2023Quote: ... Human Cot-1 DNA (Invitrogen), 3M NaAc and 100% cold EtOH ...
-
bioRxiv - Cancer Biology 2024Quote: Recombinant human EGF (Gibco #PHG0311) was added to the medium of NCI-H23 or H23 KO cells at 80% confluency to reach a final concentration of 100 ng/mL ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human Pool Set v3.0 (Thermofisher) and TaqMan™ MicroRNA Reverse Transcription Kit (Thermofisher) ...
-
bioRxiv - Genetics 2024Quote: ... human for rs2297550 from ThermoFisher.
-
bioRxiv - Molecular Biology 2020Quote: ... RNA expression analysis was performed with Affymetrix Human ClariomS® microarray using the WT Plus Reagent kit (ThermoFisher Scientific). As starting material ...
-
bioRxiv - Genomics 2019Quote: ... The mouse and human RNA samples were globin-depleted using the species-specific Ambion® GLOBINclear kit (Ambion, Thermofisher) and the RNA was quantified using a NanoDrop One spectrophotometer (Thermofisher).
-
bioRxiv - Genomics 2019Quote: ... The mouse and human RNA samples were globin-depleted using the species-specific Ambion® GLOBINclear kit (Ambion, Thermofisher) and the RNA was quantified using a NanoDrop One spectrophotometer (Thermofisher).
-
bioRxiv - Cell Biology 2019Quote: ... Unlabeled and ferumoxytol-labeled human MSCs were tested for tri-lineage differentiation potential using StemPro differentiation kits (Life technologies) for adipogeneic ...
-
bioRxiv - Cancer Biology 2019Quote: ... RNA from sorted CXCR3+ or CXCR3− SUM-LM1 cells was analyzed using Affymetrix Human U133 Plus 2.0 microarrays after cDNA preamplification using the 3’IVT Pico Reagent Kit (Affymetrix). To generate the CXCR3 signature ...