Labshake search
Citations for Thermo Fisher :
2651 - 2700 of 10000+ citations for TBARS MDA Universal Colorimetric Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... Quantitative RT-PCR was performed using the Taqman Fast Universal PCR Master Mix (Applied Biosystems, Cat# 4352042) or Sybr Green PCR Master kit (Applied Biosystems ...
-
bioRxiv - Immunology 2021Quote: ... and quantitatively detected by real-time PCR using the TaqMan® Universal PCR Master Mix (Life Technologies) with primers (forward primer - 5’ CCCATGTTTTCAGCATTATCAGAA 3’ and reverse primer-5’ CCACTGTGTTTAGCATGGTGTTTAA 3’ ...
-
bioRxiv - Microbiology 2021Quote: ... The 10-μL PCR mixture comprised 5 μL of TaqMan® Universal Master Mix II (Applied Biosystems) with uracil-N-glycosylase (UNG) ...
-
bioRxiv - Immunology 2021Quote: ... and then subjected to qPCR with the TaqMan™ Universal PCR Master Mix (Thermo Fisher Scientific, 4304437). Primers targeting the CAI locus containing GATA3 binding site are ...
-
bioRxiv - Microbiology 2022Quote: ... the SYBR supermix was replaced with iTaq™ Universal SYBR® Green Supermix (Life Technologies, Carlsbad, CA). The reaction protocol was carried out with an initial incubation of 10 min at 95 °C followed by 40 cycles of the following ...
-
Bipartite viral RNA genome heterodimerization influences genome packaging and virion thermostabilitybioRxiv - Molecular Biology 2022Quote: ... Universal upstream (TGCATAATTCTCTTACTGTCATGCCATCCGTAAG) and downstream (TAAGAGAATTATGCAGTGCTGCCATAACCATG) primers were used to target the backbone of pMT plasmids (Invitrogen). Overlapped PCR fragments were generated (Phusion High-Fidelity DNA Polymerase ...
-
bioRxiv - Genetics 2022Quote: ... the universal intermediate vector pFlexibleDT-ReCOIN was constructed through recombination of ReCOIN cassette into NotI (Thermo Fisher) and HindIII (Thermo Fisher)-digested pFlexibleDT using ClonExpress MultiS One Step Cloning Kit (Vazyme Biotech) ...
-
bioRxiv - Microbiology 2022Quote: ... PCR conditions followed the TaqMan™ Universal PCR Master Mix protocols (Thermo Fisher Scientific, Waltham, MA, USA). Quantification of gene expression was conducted using StepOne™ (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2022Quote: ... The mass spectra were collected using the “Universal” method optimized for peptide analysis provided by Thermo Scientific. Full MS scans (375–1500 m/z range ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quantification of miRNA expression was done using the TaqMan Universal PCR Master Mix (ThermoFisher Scientific, Waltham, MA). miRNA expression was normalized to U6 (assay ID ...
-
bioRxiv - Neuroscience 2022Quote: ... 2.25μL cDNA was mixed with 0.25μL 20x TaqMan Gene Expression Assays and 2.50μL of 2x TaqMan Universal PCR Master Mix (Applied Biosystems). The identification numbers and names of TaqMan probes are shown in Supplementary Table S2 ...
-
bioRxiv - Cell Biology 2024Quote: ... Quantitative RT-PCR was performed with TaqMan fast universal PCR master mix (Applied Biosystems; Foster City, CA). RT reaction conditions ...
-
bioRxiv - Molecular Biology 2024Quote: ... primers and miRNAs were detected using miRNA-specific Taqman probes and Taqman Universal PCR mastermix (Thermo Fisher). All miRNAs were normalized to hsa-miR-16 ...
-
bioRxiv - Genetics 2024Quote: ... Each reaction contained 7.5 μL of 2X TaqMan Universal PCR Master Mix (Thermo Fisher Cat. No. 4324018), 300 nM of each primer and 100 nM of probe ...
-
bioRxiv - Immunology 2024Quote: ... Gene expression was then measured by qPCR using Taqman Fast Universal PCR Master Mix (Life Technologies, #4367846). Taqman probes used in this study are ...
-
bioRxiv - Genomics 2023Quote: ... The mass spectra were collected using the “Universal” method optimized for peptide analysis provided by Thermo Scientific. Full MS scans (375–1500 m/z range ...
-
bioRxiv - Cancer Biology 2023Quote: ... Amplification of targets from cDNA was performed with the TaqMan Universal PCR Master Mix (ThermoFisher, Cat: 4304437) and TaqMan probes in a ViiA 7 Real-Time PCR System (ThermoFisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... Amplification was carried in a 25ul reaction consisting of 1x TaqMan Universal Master Mix II (ThermoFisher, MA), using 200 nM each β-actin forward (GGGATGTTTGCTCCAACCAA ...
-
A scalable, GMP-compatible, autologous organotypic cell therapy for Dystrophic Epidermolysis BullosabioRxiv - Bioengineering 2023Quote: ... Alu-qPCR was performed using 10ng of extracted DNA in triplicate using amplification protocol by Applied biosystems (Universal Master Mix II, no UNG: Applied Biosystems Cat# 4440040 and Alu Probe: ThermoFisher Scientific Cat# 4351372).
-
bioRxiv - Cancer Biology 2023Quote: ... qRT-PCR was performed using TaqMan universal PCR mix (#4324018) and predesigned TaqMan assay primers (Applied Biosystems). The following primers were used ...
-
bioRxiv - Microbiology 2023Quote: ... which contained 10 μL Luna Universal qPCR mastermix (New England Biolabs Inc., Fisher Scientific Cat. No. NC1276266), 5 μL of 10-fold diluted template DNA ...
-
bioRxiv - Genetics 2023Quote: ... Quantitative PCR (qPCR) TaqMan reactions were performed using TaqMan Universal PCR Master Mix (Applied Biosystems; Cat# 4304437). Relative expression values were calculated using the manufacturer’s software and further confirmed using the 2-ΔΔCt method.
-
bioRxiv - Developmental Biology 2023Quote: ... and a TaqMan Universal Master Mix II no UNG with a StepOnePlus RT PCR system (Applied Biosystems). Relative microRNA expression levels were normalized to RNU48 (assay ID ...
-
bioRxiv - Genomics 2023Quote: ... using TaqMan Fast Universal PCR Master Mix and CXCL14 (Assay ID Hs01557413_m1; Thermo Fisher Scientific, Waltham, MA) or C3 (Assay ID Hs00163811_m1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Polymerase chain reaction (PCR) was conducted with the Taqman® Fast Universal PCR Master Mix (Applied Biosystems). The TaqMan® probes and primers that were used are as follows ...
-
bioRxiv - Cancer Biology 2024Quote: ... Quantitative RT-PCR was performed using the Taqman Fast Universal PCR Master Mix (Cat# 4352042, Applied Biosystems) and a StepOnePlus real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Genomics 2024Quote: ... quantitative real-time RT-PCR was performed using SYBR™ Green Universal Master Mix (Applied Biosystems, 4309155) to assess gene expression ...
-
bioRxiv - Genomics 2024Quote: ... The expression of genes was studied using the Taqman universal mastermix (Applied Biosystems, Thermo Fischer Scientific, USA) (primer/probe used are provided in Supp ...
-
bioRxiv - Immunology 2024Quote: ... Quantitative real-time PCR was performed on cDNA using Taqman preAmp MasterMix and Taqman Universal Mastermix (ThermoFisher) and Assays-on-Demand probes (Gapdh ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... PCR reactions were performed using TaqMan Universal Master Mix II (4440040, Applied Biosystems, Waltham, MA, United States) and TaqMan Gene Expression Assay (4331182 and 4351372 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 15x106 cells were resuspended in 750 µl MB + 250 U/ml Pierce Universal Nuclease (Thermo Fisher Scientific) and 1X protease inhibitor (Cell Signaling ...
-
bioRxiv - Molecular Biology 2024Quote: ... according to the manufacturer’s instructions and used in qPCR reactions with 2x Universal TaqMan Master Mix (ThermoFisher) or in RT-PCR reactions with 2x PCR Master Mix (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2020Quote: ... MiRNAs or vectors were transfected in the amount of 2 μg for 6-well plate into indicated cells by Lipofectamine 2000 transfection reagent (Thermo Fisher Scientific, Waltham, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... were acid digested on a hot plate using 6 mL Primar Plus grade HNO3 (68%) and 2 mL H2O2 (Thermo Fisher Scientific, Loughborough, UK). Samples were diluted with Milli-Q water (18.2 MΩ cm ...
-
bioRxiv - Immunology 2022Quote: Isolated fractions of granulocytes and mononuclear cells (2×105/100 μl of 0.1% BSA/PBS) were incubated in 96 U-bottom plates (Thermo Fisher Scientific Inc., Waltham, MA) on ice ...
-
bioRxiv - Microbiology 2021Quote: ... Healthy cell culture of the primmorphs (2–4 mm in diameter) of green color were transferred to the 24-well plates (Nalge Nunc International, Rochester, NY, USA), 1 pieces per well ...
-
bioRxiv - Immunology 2020Quote: ... Nunc MaxiSorp ELISA plates were coated with 50 μL of capture antibody (anti-6x-His antibody clone HIS.H8; 2 μg/mL; Thermo Fisher Scientific, Waltham, MA, USA) in phosphate-buffered saline (PBS ...
-
bioRxiv - Microbiology 2022Quote: HCE-2 cells (CRL11135, ATCC, Manassas, Virginia, USA) were seeded into a Thermo Scientific™ Nunc MicroWell 96-well plate (ThermoFisher Scientific, Loughborough, UK), at 7.5×103 cells/well and grew to 80-90% confluency ...
-
bioRxiv - Molecular Biology 2022Quote: ... ACE2-expressing HEK293T cells were seeded to 24-well plates and transfected with 2 μg of each mRNAs/well using Lipofectamine™ MessengerMAX™ Transfection Reagent (Invitrogen, CA, USA). After 24 h ...
-
bioRxiv - Cell Biology 2022Quote: ... confluent pre-adipocyte (day -2) 3T3-L1s grown in 12-well plates were transfected with a pool of two anti-Mfn1 siRNAs (ThermoFisher Scientific, CatIDs: s85002 & s85004), each at 40nM to achieve a final concentration of 80nM ...
-
bioRxiv - Immunology 2024Quote: Vero-CCL81 [for MuV and VSV_RUBV] or Vero-hSLAM [for MeV-IC323] target cells which were seeded at a density of 2 × 104 cells per well in flat-bottom 96-well plates (Fisher Scientific, #08-772-3). The cells were incubated at 37 °C/5% CO2 overnight (∼20 hours) ...
-
bioRxiv - Genetics 2024Quote: ... Cells were cultured in six-well plates and transfected with DNA (2 mg/well) using Lipofectamine 3000 reagent (Thermo Fisher Scientific, Waltham, MA, USA). After 48 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... 6-well plates) siRNA and 10 μL (384-well plates) or 500 μL (6-well plates) Lipofectamine RNAiMAX in OptiMEM (Gibco, 51985-034) were incubated for 20 min at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... 100 µl/well were transferred from the “Community Plates Day 1” to U-bottom shallow 96-well plates (“Community Growth Plates Day 1”) (Fisher Scientific 168136), sealed with breathable membranes (Breathe-Easy ...
-
Control of cortical cytoskeleton-membrane interaction by RhoA regulates peripheral nerve myelinationbioRxiv - Neuroscience 2021Quote: ... the Click-iT EdU (5-ethynyl-2’-deoxyuridine) Alexa Fluor (AF) 568 imaging kit (Molecular Probes) was used in accordance with the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA (2 μg) was reverse transcribed using a high-capacity cDNA reverse transcription kit (Applied Biosystems). Primers (5’ to 3’ ...
-
bioRxiv - Genomics 2020Quote: ... 2 μg of RNA was used for reverse transcription (High Capacity cDNA Reverse Transcription Kit, ThermoFisher). Quantitative PCR detecting Gfi1b and Actb was carried out using SYBR green master mix (Bio-Rad) ...
-
bioRxiv - Bioengineering 2019Quote: ... 2 µg of RNA were reverse transcribed using High-Capacity RNA-to-cDNA Kit (Applied Biosystems) following to the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2020Quote: ... injection of EdU (5-ethynyl-2’-deoxyuridine; Click-it EdU Alexa Fluor 488 imaging kit, Invitrogen) at 5 and 6 days DPD at 50 mg/kg ...
-
bioRxiv - Pathology 2022Quote: Total RNA was extracted from the C3H/10T1/2 cells using Trizol RNA extraction kit (Invitrogen). A total of 1 µg of extracted RNA was transcribed into cDNA using GoScript Reverse Transcription Kit (Promega) ...