Labshake search
Citations for Thermo Fisher :
2551 - 2600 of 10000+ citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... USDA 110 was cultivated in PSY medium supplemented with L-(+)-arabinose (1 g/l) (Thermo Scientific A11921) [34] ...
-
bioRxiv - Biochemistry 2022Quote: ... 10 mM HEPES (N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid) and 1% (v/v) penicillin/streptomycin (P/S) (all from Thermo Fisher Scientific, Waltham, MA, USA). Then ...
-
bioRxiv - Immunology 2019Quote: ... 5’-CCCTACTGTATCCTCATG-3’/5’-CTTACCTCCTCTTCAATAGC-3’ PRKDC: 5’-GGGGCATTTCCGGGTCCGGG-3’/5’-TGCCCTGCCCCCCACTCTGC-3’ Amplicons were cloned using the Zero Blunt TOPO PCR Cloning kit (ThermoFisher), prepared as plasmids ...
-
bioRxiv - Cell Biology 2022Quote: ... Guide RNA primer sets A (KS40 5’-ACCGACCACAGAAACTGCGACTAG -3’ and KS41 5’-AACCTAGTCGCAGTTTCTGTGGTC-3’) and B (KS42 5’-CCGTCCCACTGGCACCGCTTTATG-3’ and KS43 5’-AAACATAAAGCGGTGCCAGTGGGA-3’) were phosphorylated with T4 polynucleotide kinase (ThermoFisher) at 37°C for 30 min and annealed by cooling down from 85°C to 25°C at 0.1°C/sec ...
-
bioRxiv - Biochemistry 2021Quote: ... and/or ToPro-3-3 (1 μM; Thermo-Fisher Scientific, Waltham, MA) for 10 minutes at RT ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) was purchased from Life Technologies/Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... #3: 5′-GAAUAUUGAACUGGAAGCAGCACAU-3′) were purchased as Stealth RNAi siRNAs from Invitrogen. The target sequences were designed using the Block-iT RNAi Designer tool (Invitrogen ...
-
bioRxiv - Genetics 2022Quote: ... 20 mL of 3 mM of 3-deoxyadenosine (cordycepin; Thermo Fisher Scientific) was added to the buffer to obtain a final concentration of 0.6 mM (150 mg/L) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... the oligonucleotides 5’-CCTGTGCAGCCGTCCATAGGGCCTGTCAGTCAGTGGCCAAAACAGGCCTAT GAGGACGGCTGCAC-3’ and 5’-TGCTGTGCAGCCGTCCTCATAGGCCTGTTTTGGCCACTGACTGACAGGCCTATGGACGGCTGCA-3’ (#Mmi520981, Invitrogen) were used ...
-
bioRxiv - Genomics 2020Quote: ... Day 3 SP34 (Invitrogen) with 5 ng/ml BMP4 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3’-Diaminobenzidine (Invitrogen, 750118) as a substrate ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 mM DTT (Invitrogen) and 40 units RNAse OUT (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μM MMC (ThermoFisher) for 6 hours ...
-
bioRxiv - Cell Biology 2022Quote: A 3% agarose (Invitrogen) gel solution was prepared in PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... IL-3 (Life Technologies), Dexamethasone (Sigma) ...
-
bioRxiv - Systems Biology 2020Quote: ... QuantStudio 3 qPCR (Thermofisher) with KAPA Library Quantification Kit (Roche) ...
-
bioRxiv - Cell Biology 2020Quote: ... SUMO-2/3 (Invitrogen); β-Catenin (BD Transduction Laboratories) ...
-
bioRxiv - Immunology 2022Quote: ... and 3% FBS (Invitrogen). Epidermal sheets were separated from the dermis after incubation for 45 min at 37°C in 2.4 mg/ml of Dispase and 3% FBS and the epidermis was further digested for 30 min in PBS containing 1 mg/ml collagenase D ...
-
bioRxiv - Neuroscience 2022Quote: ... QuantStudio 3 from ThermoFisher was used ...
-
bioRxiv - Bioengineering 2024Quote: ... Qubit 3 (Fisher Scientific) and 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Genetics 2024Quote: ... 3% ES-FBS (Gibco), 0.1 mM β-Mercaptoethanol (Gibco) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... on QuantStudio 3 (ThermoFisher) and data were quantified by the 2-ΔΔCT method.
-
bioRxiv - Biophysics 2023Quote: ... DiIC18(3) stain (Invitrogen). Transferrin from Human Serum ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 mL Trizol (ThermoFisher) was added to 1 mL of cellular PBS suspension in a 15 mL test tube ...
-
bioRxiv - Biophysics 2023Quote: ... 3 mM DDT (Invitrogen), 1.5 µM of primers listed in Supplemental Table S6 ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% FBS (Invitrogen, 16140071), 1% GlutaMAX ...
-
bioRxiv - Cell Biology 2024Quote: ... QuantStudio 3 (Thermo Fisher) was used for quantification using a standard curve method.
-
bioRxiv - Microbiology 2021Quote: ... mixed with forward and reverse detection primers (T3DCD S1 forward [5’- TACGCGTTGATCACGACAAT-3’] and T3DCD S1 reverse [5’- TGGCGAGATTATTCCCTGAC-3’] or GAPDH forward [5’- ACCCAGAAGACTGTGGATGG-3’] and GAPDH reverse [5’- GGATGCAGGGATGATGTTCT-3’]) and SYBR Select Master Mix (Applied Biosystems), and then subjected to PCR using the StepOnePlus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... and customized si-KIF4 3′ UTR targeting endogenous KIF4 mRNA 3’-UTR region (5′-GGAAUGAGGUUGUGAUCUUTT-3′) were purchased from Thermo Fisher Scientific.
-
bioRxiv - Cell Biology 2020Quote: ... reverse: 5’-GGGGTCGGGAGGAACGG-3’ (Macrogen, South Korea) and beta-actin forward: 5’-CCTGGTCGGTTTGATGTT-3’ and reverse: 5’-GTGCGACGAAGACGA-3’ (Invitrogen, USA). Data analysis was made in CFX ManagerTM Software (BioRad ...
-
The skin environment controls local dendritic cell differentiation and function through innate IL-13bioRxiv - Immunology 2021Quote: ... FW 5’-CTCTCTGGGCGAAATCTGCT-3’ and REV 5’-GAGTGCTTTCGCTATGTTGTTCA-3’ for Clmn and FW 5’-TGATGGGTGTGAACCACGAG-3’ and REV 5’-GCCGTATTCATTGTCATACCAGG-3’ for Gapdh using a QuantStudio 7 (Applied Biosystems). Transcript levels are expressed as the ratio of 2−ΔCT (Transcript of interest)/2−ΔCT (Gapdh).
-
bioRxiv - Bioengineering 2021Quote: ... the non-viable cells were removed by a trypsin–EDTA solution (0.5 g/L trypsin and 0.2 g/L EDTA, Gibco) and the cells were shifted to a new tissue culture flask [21].
-
bioRxiv - Bioengineering 2020Quote: ... HeLa cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM, as received with L-Glutamine, 4.5 g/L D-glucose and pyruvate, Gibco) supplemented with FBS 5% (Gibco ...
-
bioRxiv - Cell Biology 2020Quote: The mouse muscle cell line C2C1254 were cultured in growth media (Dulbecco’s Modified Eagle Medium (4.5 g/l D-Glucose, No L Glutamine, No Sodium Pyruvate (Gibco))+20% Fetal Bovine Solution-One Shot (Gibco)+1% Glut Max 100x (Gibco)) ...
-
bioRxiv - Biophysics 2020Quote: ... 400 μl of ‘imaging DMEM’ ([+] 4.5 g/L D-Glucose, [+] L-Glutamine, [+] 25 mM HEPES, [-] Sodium Pyruvate, Gibco) was added to an Eppendorf tube together with 3 μl and 7 μl of 1 μm and 4.95 μm VN coated beads ...
-
bioRxiv - Cancer Biology 2022Quote: ... MDA-MB-231 and MDA-MB-468 cells were grown in high glucose (4.5 g/L) or low glucose (1.0 g/L) DMEM media (ThermoFisher) supplemented with 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... HCC70 cells were cultured in high glucose (4.5 g/L) or low glucose (1.0 g/L) RPMI-1640 media (ThermoFisher) supplemented with 10% FBS and 1% Pen/Strep ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 g/L Bovine Serum Albumin (BSA, Fischer Scientific) and 200 mg/L Salmon Sperm DNA solution (Invitrogen).
-
bioRxiv - Microbiology 2020Quote: ... the primary substrates were 24.7 ± 0.5 mM fructose (148.2 ± 3.2 mmol C L−1) and 18.7 ± 1.0 mM Na-butyrate (112.2 ± 6.3 mmol C L−1) (ThermoFisher, Kandel, Germany). For the pH experiment ...
-
bioRxiv - Cell Biology 2021Quote: Human SH-SY5Y neuroblastoma cells were maintained in growth media composed of Dulbecco’s Modified Eagle Medium (DMEM 1X + GlutaMAX, 4.5 g/L D-glucose, 110 mg/L sodium pyruvate; Invitrogen) containing 10% bovine growth serum (BGS ...
-
bioRxiv - Microbiology 2020Quote: ... kidney cells were grown in Dulbecco’s modified Eagle medium containing 4.5 g/L glucose and L-glutamine (Gibco), supplemented with 10% fetal calf serum (FCS ...
-
bioRxiv - Molecular Biology 2022Quote: ... VEGFR2 (Dharmacon/Horizon, #L-003148-00-005), CDH5 (Dharmacon/Horizon, #L-003641-00-0005) using Lipofectamine RNAiMax (Invitrogen) in 2% OPTI-MEM ...
-
bioRxiv - Molecular Biology 2022Quote: ... Transient transfection was performed using 30 nmol/L siRNA or 25 nmol/ L ASO and Lipofectamine RNAiMAX (Invitrogen).
-
bioRxiv - Physiology 2022Quote: C2C12 myoblasts were grown in high-glucose DMEM (4.5 g/L glucose, with L-glutamine; Gibco 11965-092) supplemented with 10% FBS (heat-inactivated ...
-
bioRxiv - Microbiology 2022Quote: ... diluted to 50% with PBS with 100 mg/L CaCl2 and 100 mg/L MgCl2 (“PBS+”; Gibco 14040133), and passed through a 0.2 μm filter ...
-
bioRxiv - Microbiology 2023Quote: ... Germany) and stimulated with 2.4 μg/ ml phytohemagglutinin-L (PHA-L) solution (500 x) (Invitrogen, Waltham, MA, USA) for five days ...
-
bioRxiv - Cell Biology 2023Quote: Cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM 1X, containing pyruvate and 4.5 g/L D-glucose, L-glutamine from Gibco, Life Technologies Billings ...
-
bioRxiv - Cell Biology 2023Quote: ... AlexaFluor 647 goat anti-sheep IgG (H+L) and AlexaFluor 633 goat anti-rat IgG (H+L) (Invitrogen); IRDye 680RD goat anti-mouse and IRDye 800CW goat anti-rabbit (LI-COR).
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 4 mM L-alanyl-L-glutamine and NucBlue nucleus staining reagent (1 drop per mL) (Invitrogen). Plates were incubated for 15 min (37 °C ...