Labshake search
Citations for Thermo Fisher :
2501 - 2550 of 10000+ citations for WY 45494 hydrochloride CAS 93413 90 2 99% since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2021Quote: ... after DNAse treatment (Invitrogen, Carlsbad, CA, USA), cDNA synthesis was performed using the SensiFAST cDNA Synthesis Kit (Bioline ...
-
bioRxiv - Cell Biology 2021Quote: ... Pgk1 (Life Technologies, Carlsbad, CA, 1:10,000), and Pep12 (Life Technologies ...
-
bioRxiv - Physiology 2020Quote: ... C1q Mm00432162_m1 (Applied Biosystems, Carlsbad, CA, USA) and were run on the CFX96 Touch Real-Time PCR machine (BioRad ...
-
bioRxiv - Neuroscience 2020Quote: ... with B27 supplement (Life Technologies, Carlsbad, CA), 0.5mM Glutamax (Life Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... PKI ([14-22], Myristoylated) (Invitrogen, Camarillo, CA), a synthetic peptide inhibitor of PKA ...
-
bioRxiv - Biochemistry 2021Quote: ... Gal-Screen (Applied Biosystems, Foster City, CA), following the standard protocol recommended by the manufacturer ...
-
bioRxiv - Cell Biology 2021Quote: ... using SYBR Green (Invitrogen, Carlsbad, CA, USA) and specific primers (Table 1) ...
-
bioRxiv - Cell Biology 2021Quote: ... mimics and negative controls (Invitrogen, Carlsbad, CA) were resuspended in RNase-free H2O at 50 μM for in vitro cell transfections ...
-
bioRxiv - Systems Biology 2021Quote: ... Automated Fraction Collector (Thermo Scientific, CA, USA) and a Rheodyne MXII Valve (IDEX Health & Science LLC ...
-
bioRxiv - Cancer Biology 2020Quote: ... and penicillin/streptomycin (Life Technologies, Benicia, CA) in a 37°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... with 5 µM CalceinBlue (Invitrogen, CA, USA) and a 1:200 dilution of Molecular Probes Fixable Live/Dead Near-IR Dead Cell Stain Kit (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... USA) or from Invitrogen (Carlsbad, CA, USA). Unconjugated lectins were purchased from either EY laboratories (San Mateo ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Tissues were stored in RNAlater (ThermoFisher, CA) until further use.
-
bioRxiv - Evolutionary Biology 2021Quote: Custom SNP genotyping TaqMan assay (ThermoFisher, CA) were applied to perform genotypic analysis of the SNP of interest in exon 4 of BCO2 ...
-
bioRxiv - Neuroscience 2020Quote: ... supplemented with 10% FBS (Invitrogen, Carlsbad, CA). To create stable CRISPR/Cas9 edited cell lines ...
-
bioRxiv - Microbiology 2020Quote: ... and reverse primer “GGACTACCAGGGTATCTAATCCTGTT” (Invitrogen, Carlsbad, CA).(3 ...
-
bioRxiv - Microbiology 2020Quote: ... stained with SYBR Gold (Invitrogen, Carlsbad, CA), and counted at 100x magnification on an epifluorescent microscope ...
-
bioRxiv - Immunology 2021Quote: ... and viability stain (Invitrogen, Carlsbad, CA, U.S.) for 15 minutes at 4°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... and blocked with CAS-block (Thermofisher, 88120) at room temperature for 30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 293T cells (Life Technologies, Carlsbad, CA, USA) were seeded in ten 15 cm2 dishes with 13-15×106 cells per plate ...
-
bioRxiv - Immunology 2020Quote: ... AF647-sAv (Invitrogen, Carlsbad CA, 1:200)) ...
-
bioRxiv - Immunology 2020Quote: ... MCP-1 and CXCL1 (Invitrogen, Carlsbad, CA). Electrochemiluminescence ELISAs (Meso Scale Diagnostics ...
-
bioRxiv - Immunology 2020Quote: ... and M-CSF (Life Technologies, Carlsbad, CA) brought to a concentration of 20ng mL−1 ...
-
bioRxiv - Immunology 2020Quote: ... CD45RO (UCHL1)(all Life Technologies, Carlsbad, CA), and CD44 (G44-26 ...
-
bioRxiv - Immunology 2021Quote: ... coli BL21 (DE3, Invitrogen, Carlsbad, CA, USA) was prepared as previously described (16) ...
-
bioRxiv - Immunology 2021Quote: ... protein stabilizing cocktails (Thermo Fisher, Carlsbad, CA) and bovine serum albumin were added ...
-
bioRxiv - Neuroscience 2021Quote: ... 10 ng/mL NGF (Invitrogen, Carlsbad, CA), 30 ng/mL NT-3 (Peprotech ...
-
bioRxiv - Immunology 2022Quote: ... using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s protocol or an in-well electro-transfection approach (Lonza) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Baseline-ZERO DNase (Ambion, Foster City, CA); Benzonase (NEB) ...
-
bioRxiv - Cancer Biology 2022Quote: ... MitoTracker Green solution (Life Technologies, Carlsbad, CA) was incubated with the cells for 30 minutes (2D ...
-
bioRxiv - Biophysics 2022Quote: ... in CAS-Block reagent (Life Technologies, 008120) at 4°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... using 0.4% Trypan Blue (Invitrogen, Carlsbad, CA). Single-cell droplet encapsulation was performed using the Single Cell G Chip and the 10x Genomics Chromium Controller ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 mM sodium pyruvate (Gibco, Carlsbad, CA), 50 μg/ ml ascorbic acid (Sigma ...
-
bioRxiv - Bioengineering 2022Quote: ... 1% Insulin-TransferrinSelenium (ITS, Gibco, Carlsbad, CA), 1 mM sodium pyruvate (Gibco ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 mM Glutamine (Life Technologies, Carlsbad, CA) and 1% Penicillin-Streptomycin (Life Technologies) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and Qubit Fluorometer (Invitrogen, Carlsbad, CA, USA), respectively ...
-
bioRxiv - Immunology 2022Quote: ... One microgram of RNA of each sample was reverse transcribed with the High-Capacity cDNA Reverse Transcription kit from Applied Biosystems (Applied Biosystems/Life Technologies, Carlsbad, CA, USA) using random primers in a final volume of 20 μl ...
-
bioRxiv - Immunology 2022Quote: ... One microgram of RNA of each sample was reverse transcribed with the High-Capacity cDNA Reverse Transcription kit from Applied Biosystems (Applied Biosystems/Life Technologies, Carlsbad, CA, USA) using random primers in a final volume of 20 μl ...
-
bioRxiv - Genomics 2022Quote: ... Trizol reagent (Invitrogen, Carlsbad, CA, United States) was added to extract total RNA using the Direct-zol RNA Mini Prep Plus kit (Zymo Research ...
-
bioRxiv - Microbiology 2022Quote: ... Gal-Screen (Applied Biosystems, Foster City, CA), following the standard protocol recommended by the manufacturer ...
-
bioRxiv - Microbiology 2022Quote: ... and 1.5 mM MgCl2 (Invitrogen, CA, USA). The thermal program comprised an initial denaturation step of 4 min at 94 °C ...
-
bioRxiv - Immunology 2022Quote: ... dissolved in RPMI 1640 (Invitrogen, Carlsbad, CA) containing 10% FCS ...
-
bioRxiv - Microbiology 2022Quote: ... 0.2 mM NTPS (Invitrogen, Carlsbad, CA, USA), 1 μM of each primer ...
-
bioRxiv - Plant Biology 2022Quote: ... TURBO™ DNase (Ambion, Carlsbad, CA, USA) was used to remove the remaining DNA from isolated RNA samples ...
-
bioRxiv - Molecular Biology 2023Quote: ... pJET1.2/blunt (Thermo Scientific, Carlsbad, CA, USA) and pBluescript II SK (+ ...
-
bioRxiv - Genomics 2022Quote: ... Proteinase K (Invitrogen Life Technologies, Carlsbad, CA) was used to digest proteins at the junction point to disconnect the crosslink of the protein and DNA ...
-
bioRxiv - Genomics 2022Quote: ... Proteinase K (Invitrogen Life Technologies, Carlsbad, CA) was used to digest proteins at the junction point to disconnect the crosslink of the protein and DNA ...
-
bioRxiv - Plant Biology 2022Quote: ... according to manufacturer’s specifications (Invitrogen, CA, USA). The primers contained the appropriate attb sites ...
-
bioRxiv - Plant Biology 2022Quote: ... Plant RNA purification Reagent (Invitrogen, CA, USA) was used ...
-
bioRxiv - Microbiology 2023Quote: ... Gal-Screen (Applied Biosystems, Foster City, CA), following the standard protocol recommended by the manufacturer ...