Labshake search
Citations for Thermo Fisher :
2501 - 2550 of 10000+ citations for Nucleic Acid Electrophoresis Gel since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2022Quote: ... The gels were dried using the DryEase mini Gel Drying systems (Invitrogen) according to the manufacture protocol ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Gel fragments were extracted using GeneJet Gel extraction kit (Thermo Fisher Scientific). Ligations were performed using Quick Ligation™ Kit (New England Biolabs) ...
-
bioRxiv - Cell Biology 2024Quote: ... The gels were stained with SYPRO Ruby Protein Gel Stain (Invitrogen, S12000) following manufacturer’s instructions and imaged with iBrightCL 1000 on fluorescent protein gel setting.
-
bioRxiv - Immunology 2024Quote: ... PCR products were resolved using E-gel 96 Agarose Gels 2% (Invitrogen). SPRIselect beads (Beckman Coulter ...
-
bioRxiv - Immunology 2023Quote: ... Reverse: ACATCTAAGGGCATCACAGACC) and purified by gel extraction (Quick Gel Extraction kit, Invitrogen). qPCR was performed on a QuantStudio 7 flex and expression calculated using standard curves and results normalised to 18s expression ...
-
bioRxiv - Genetics 2023Quote: ... Samples were further purified by 2% E-Gel SizeSelect agarose gel (Invitrogen). The resulting products were purified using QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2022Quote: ... Gels were loaded to NuPage 4-12% Bis-Tris precast gels (ThermoFisher) and transferred to PVDF membranes before being blocked using 5% milk / PBS / 0.1% Tween ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The amplified products were gel purified (GeneJET Gel Extraction Kit; Thermo Scientific) and TA-cloned (InsTAclone PCR Cloning Kit ...
-
bioRxiv - Neuroscience 2023Quote: ... The gel (4-12% Bis-Tris NuPAGE® gel, Life Technologies, NP0322BOX) was loaded into the tank with running buffer (20x NuPAGE® MOPS SDS Running Buffer in deionised water ...
-
bioRxiv - Neuroscience 2023Quote: ... samples were electrophoresed through 10% acrylamide gels in Mini Gel Tanks (Invitrogen) filled with 1x tris-glycine-SDS running buffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... gels were either stained with Gel-Code™ Protein Stain (24590, ThermoFisher) or transferred to 0.2-micron PVDF membranes (1620174 ...
-
bioRxiv - Molecular Biology 2023Quote: ... was purified from the agarose gel with GeneJet Gel Extraction kit (ThermoFisher) and sequenced by Ion Torrent and the obtained reads were mapped in the reference sequence ...
-
bioRxiv - Immunology 2020Quote: For acid induced unfolding experiments the hydrophobic dye BIS-ANS (4,4’-dianilino1,1’-binaphthyl-5,5’-disulfonic acid, Invitrogen) was used to monitor protein unfolding by fluorescence spectroscopy with an excitation wavelength of 390 nm ...
-
bioRxiv - Immunology 2023Quote: ... and 1X non-essential amino acids (MEM non-essential amino acids solution 100X, Gibco, Waltham, Massachusetts, USA). Cell cultures were maintained at 37 °C and 5% CO2 ...
-
bioRxiv - Biophysics 2020Quote: ... Bis-Tris gels (Invitrogen). Talin ABS proteins were desalted in a 40kDa MWCO Zeba desalting column (Thermo Scientific) ...
-
bioRxiv - Immunology 2022Quote: ... Bis-Tris gels (Invitrogen) SDS-polyacrylamide NuPAGE™ gels Gels were ransferred to a nitrocellulose membrane by the iBlot Gel Transfer System (Invitrogen) ...
-
bioRxiv - Immunology 2022Quote: ... Midi Protein Gel (Invitrogen) for 45 - 60 min at 175 V ...
-
bioRxiv - Biochemistry 2022Quote: ... Mini Protein Gel (Invitrogen) pre-cast gels were used for Clear Native (CN ...
-
bioRxiv - Developmental Biology 2020Quote: ... Bis-Tris Gel (Invitrogen) or Mini-PROTEAN 4–15% Gels (Bio-Rad ...
-
bioRxiv - Developmental Biology 2019Quote: ... 2% (E-Gel, GIBCO). DNA fragments from the complete and size-selected library were detected and confirmed ...
-
bioRxiv - Immunology 2020Quote: ... Mini Protein Gel (Invitrogen) for 30 min at 175 V or NuPAGE™ 4 to 12% ...
-
bioRxiv - Immunology 2020Quote: ... Midi Protein Gel (Invitrogen) for 45-60 min at 175 V ...
-
bioRxiv - Microbiology 2021Quote: ... gel purified (ThermoFisher Scientific) and Gibson assembled into pSRK (44 ...
-
bioRxiv - Immunology 2022Quote: ... Midi Protein Gel (Invitrogen) for 45–60 min at 175 V ...
-
bioRxiv - Molecular Biology 2022Quote: ... Mini Protein Gels (Invitrogen). Electrophoresis occurred at 150 V ...
-
bioRxiv - Neuroscience 2022Quote: ... Bis-Tris Gel (Invitrogen) or Mini-PROTEAN 4–15% Gels (Bio-Rad ...
-
bioRxiv - Molecular Biology 2023Quote: ... Bis-Tris gels (Invitrogen), according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... Mini Protein Gels (Invitrogen) using MES buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... Bis-Tris gel (Invitrogen) and electrophoresed for 45 min at 200 V ...
-
bioRxiv - Neuroscience 2023Quote: ... 1.0 mm gels (Invitrogen) soaked in commercially obtained Bolt™ MOPS or MES SDS running buffers (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... NuPAGE gels (ThermoFisher Scientific) with MOPS buffer and transferred overnight at 4°C onto nitrocellulose membranes (GE Healthcare ...
-
bioRxiv - Cell Biology 2023Quote: ... polyacrylamide gel (Life Technologies), and transferred to a Hybond N+ membrane (Cytiva ...
-
bioRxiv - Immunology 2023Quote: ... Bis–Tris gel (Invitrogen) and run for 45 min at 200 V ...
-
bioRxiv - Genetics 2023Quote: ... Tris-Acetate gel (Invitrogen) and transferred to a polyvinylidene fluoride membrane ...
-
bioRxiv - Cell Biology 2023Quote: ... Mini Protein Gel (ThermoFisher). After SDS-PAGE ...
-
bioRxiv - Biochemistry 2023Quote: ... Bis-Tris gels (ThermoFisher) were run using cathode buffer B (50 mM Tricine ...
-
bioRxiv - Cancer Biology 2023Quote: ... Bis-Tris gels (Invitrogen). Proteins were transferred on to Immun-Blot PVDF membranes (Bio-Rad ...
-
bioRxiv - Immunology 2023Quote: ... Midi Protein Gel (Invitrogen) for 45 - 60 min at 175 V ...
-
bioRxiv - Microbiology 2019Quote: ... The PCR amplified products were run on 1.5% agarose gel and the specific amplified band was eluted using gel elution kit (GeneJET Gel Extraction Kit; Thermo Scientific, USA). Sequence determination was performed for both the strands of the DNA by Chromous Biotech ...
-
bioRxiv - Microbiology 2019Quote: ... The PCR product was gel purified from a 1% agarose gel using a GeneJET gel extraction kit (Thermo Scientific, Dublin, Ireland) and ligated into pGEM-T Easy vector (Promega ...
-
bioRxiv - Plant Biology 2021Quote: ... The PCR products were separated on an agarose gel and the DNA fragments were extracted from the gel by GeneJET gel extraction kit (#K0691, ThermoFisher scientific). The DNA fragments were cloned in pJET1.2 vectors by using CloneJET PCR cloning kit (#K1232 ...
-
bioRxiv - Plant Biology 2022Quote: ... the gel was stained with Sun-Gel staining solution (LPS Solution; Korea) and dried using a gel dryer (HoeferTM GD2000 Gel Dryer System; Fisher Scientific). Radioactivity was deteced using a phosphorimager (BAS-2500 ...
-
bioRxiv - Microbiology 2023Quote: ... the libraries were checked for correct fragment length on an E-Base device using E-Gel 96 Gels with 2% mSYBR Safe DNA Gel Stain (Fisher Scientific), quantified with a QuantiFluor dsDNA System (Promega) ...
-
bioRxiv - Immunology 2022Quote: ... using the XCell Mini-cell electrophoresis system in 1X MES SDS Running Buffer (Life Technologies). Proteins were transferred to a nitrocellulose membrane using the XCell II Blot Module and 1X Bolt Transfer Buffer with 20% methanol (Life Technologies) ...
-
bioRxiv - Microbiology 2022Quote: ... Following electrophoresis samples were transferred to nitrocellulose membrane using the iBlot 2 transfer system (ThermoFisher) and probed with antibodies against GFP and B ...
-
bioRxiv - Cancer Biology 2020Quote: ... Proteins electrophoresis and transfer were performed using the XCell SureLock and the iblot system (Invitrogen), respectively ...
-
bioRxiv - Microbiology 2021Quote: ... After electrophoresis the proteins were transferred to a polyvinylidene difluoride membrane (ThermoFisher Scientific, MA, USA) according to the manufacturer’s specification ...
-
bioRxiv - Immunology 2020Quote: ... and separated by size using capillary electrophoresis on an ABI3730 sequencer (ThermoFisher Scientific, Darmstadt, Germany). Data analysis was performed with GeneMapper 4.0 software (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were analyzed by capillary electrophoresis on an ABI 3730×1 DNA analyzer (Life Technologies). The DNA probe only with no added VxrB was analyzed in parallel ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reactions were analyzed by capillary electrophoresis on an ABI 3130XL Genetic Analyzer from Applied Biosystems.